View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4109_high_6 (Length: 205)
Name: NF4109_high_6
Description: NF4109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4109_high_6 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 24 - 187
Target Start/End: Complemental strand, 16253227 - 16253063
Alignment:
| Q |
24 |
aatgttattagttttgttagttagaaatatttttgcattaaattcatttcagtttattaaatgcatgaattgtggcattcggaaaag-nnnnnnnnnggt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
16253227 |
aatgttattagttttgttagttagaaatatttttgcattaaattcattttagtttattaaatgcatgaattgtggcatttggaaaagaaaaaaaaaaggt |
16253128 |
T |
 |
| Q |
123 |
gtacttgtttgacaatggtcacaatcttgcccgaaaatttcctagttttgtttatttggtttcaa |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16253127 |
gtacttgtttgacaatggtcacaatcttgcccgaaattttcctagttttgtttatttggtttcaa |
16253063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University