View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4110_high_6 (Length: 322)
Name: NF4110_high_6
Description: NF4110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4110_high_6 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 9 - 322
Target Start/End: Complemental strand, 33268998 - 33268684
Alignment:
| Q |
9 |
tgatcctg-gagaagaggagtacgggaatctcgagctgttcctgcacctgatgccaatgctgaactggtagtgtcaatgcaggtaaaatcattgttaatt |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268998 |
tgatcctgagagaagaggagtacgggaatctcgagctgttcctgcacctgatgccaatgctgaactggtagtgtcaatgcaggtaaaatcattgttaatt |
33268899 |
T |
 |
| Q |
108 |
tcgatattgtcacaacttgttcatttgtggatttgtcattgctgtttatagatgatattgttctgtttgctgaaatcaaacatcctttcaagtgcatatg |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268898 |
tcgatattgtcacaacttgttcatttgtggatttgtcattgctgtttatagatgatattgttctgtttgctgaaatcaaacatcctttcaagtgcatatg |
33268799 |
T |
 |
| Q |
208 |
tctttttgataaacaccaagatcagttaggtctctcaaatgcatcatatatatcatctggatgaactcttcctttatgcgtcaaataagtatgtgtatgg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268798 |
tctttttgataaacaccaagatcagttaggtctctcaaatgcatcatatatatcatctggatgaactcttcctttatgcgtcaaataagtatgtgtatgg |
33268699 |
T |
 |
| Q |
308 |
catcttaagataaaa |
322 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
33268698 |
catcttaagataaaa |
33268684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University