View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4110_high_8 (Length: 319)
Name: NF4110_high_8
Description: NF4110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4110_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 316
Target Start/End: Complemental strand, 10599130 - 10598831
Alignment:
| Q |
17 |
tagttcgtttttatatgctagcctgttgagtggtgctgcttgtattggtacaataggtaagggtgaacaaattcatgccatggtggtgaagatgggattt |
116 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
10599130 |
tagttcgtttacatatgctagcctcttgagtggtgctgcttgtattggtacaattggtaagggtgaacaaattcatgccatggtggttaagattggattt |
10599031 |
T |
|
| Q |
117 |
cggactgacctaagtgttaataatgctttgatctctatgtattctaagtgtggaaacaaagaagctgctttacaggtctttaatgacatggaagatcgca |
216 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
10599030 |
cggactgacttaagtgttaataatgctttgatctctatgtattccaagtgtggaaacaaagaagctgctttacaggtctttaatgacatggaagattgca |
10598931 |
T |
|
| Q |
217 |
atgtcataacttggacctctatcataaatggttttgcaaaacatgggtttgctacaaaagcactagaattgttctatgatatgctcaaaacaggtgtgaa |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
10598930 |
atgtcataacttggacctctatcataaatggttttgcaaaacatggatttgcttcaaaagcactagaattgttctataatatgcttgaaacaggtgtgaa |
10598831 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University