View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_high_36 (Length: 242)
Name: NF4111_high_36
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_high_36 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 19 - 242
Target Start/End: Original strand, 30965778 - 30965999
Alignment:
| Q |
19 |
aactaagctcgtccaagagacaggtagccaaacctgcttgaattatgaattgtggaatgaaaaggttaatatggaattggcaaagctaatatgattatcc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
30965778 |
aactaagctcgtccaagagacaggtagccaaacctgcttgaattatgaattgtggaatgaaaaggttaatatggaattggcaaagctaatatgattattc |
30965877 |
T |
|
| Q |
119 |
ctttatggcttgatgcaagactttatcctaaatttttcagtgacattctggttgattctgttttaaaaaatgaaatgcagtagatactttctgttnnnnn |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30965878 |
c-ttatggcttgatgcaagactttatcctaaatttttcagtgacattctgattgattctgttttaaaaaatgaaatgcagtggatactttctgtt-aaaa |
30965975 |
T |
|
| Q |
219 |
nnttataaaaatactcttgatatt |
242 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
30965976 |
aattataaaaatactcttgatatt |
30965999 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University