View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4111_high_38 (Length: 237)

Name: NF4111_high_38
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4111_high_38
NF4111_high_38
[»] chr4 (1 HSPs)
chr4 (1-188)||(46853668-46853855)


Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 46853668 - 46853855
Alignment:
1 aatttacattactcttcttccatgatgtcttaccagccattttgggtttaaaaaagttggattcatatgggatattaagtaaatactaattatgtgtttt 100  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||||||||||||||| || |||||||||||||||||    
46853668 aatttacattactcttcttccatgatgtcttaccaaccattttgggtttaaaagagttagattcatatgggatattaagcaagtactaattatgtgtttt 46853767  T
101 gatggcatggttgttattcattatttctttatgcgcaaacaattccatattatcgtctatatacctcaggttaaatcacgtacaatat 188  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||  |||||||    
46853768 gatgacatggttgttattcattatttctttatgcgcaaacaattccatattatcgtctatataccttaggttaaatcacacacaatat 46853855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University