View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_25 (Length: 390)
Name: NF4111_low_25
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-106; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-106
Query Start/End: Original strand, 19 - 247
Target Start/End: Original strand, 39583199 - 39583427
Alignment:
| Q |
19 |
gtttcacacatagaacatgttttgttttagtccttctctctgtctccaatgcaaaagcacatgttatcattgctggctggcacaagagatgagaatgtca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583199 |
gtttcacacatagaacatgttttgttttagtccttctctctgcctccaatgcaaaagcacatgttatcattgctggctggcacaagagatgagaatgtca |
39583298 |
T |
 |
| Q |
119 |
caccannnnnnnctcaggtcaacacttgccatataagcatttatggtaaatgctgtgaaaaccaatattttgaaagggaaagaaaaactagagatcagaa |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583299 |
caccatttttttctcaggtcaacacttgccatataagcatttatggtaaatgctgcgaaaaccaatattttgaaagggaaagaaaaactagagatcagaa |
39583398 |
T |
 |
| Q |
219 |
atgcttatattgagacttcagaagttcat |
247 |
Q |
| |
|
||||||||| ||||||||||||||||||| |
|
|
| T |
39583399 |
atgcttatactgagacttcagaagttcat |
39583427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 315 - 375
Target Start/End: Original strand, 39583495 - 39583555
Alignment:
| Q |
315 |
tagcagaaaagaagtaaaacacgccgcagttgtttccttttctattgatcaggaacttggt |
375 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39583495 |
tagcagaaaagaagtaaaacacgccgcagttgtttccttttctattgatcaggaacttggt |
39583555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University