View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_27 (Length: 349)
Name: NF4111_low_27
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 18 - 314
Target Start/End: Complemental strand, 37471313 - 37471019
Alignment:
| Q |
18 |
aataggatattggtaaaattggaagagaaacttggaaagaacctctgacgacagctcataggcgcagttgttgacggcaaacgaacggagacacaaataa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37471313 |
aataggatattggtaaaattggaagagaaacttggaaagaacctctgacgacagctcataggcgcagttgttgacggcaaacgaacggagacacaaataa |
37471214 |
T |
 |
| Q |
118 |
aacaaaacatcatctttcttctttgtatttgaacaacgttaattcattcaattgnnnnnnnnnnngttcaaattccggtgaggcctacggtggtgaaaca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
37471213 |
aacaaaacatcatctttcttctttgtatttgaacaacgttaattcattcaattg--tttttttttgttcaaattccggtgaggcctacggtggtgaaaca |
37471116 |
T |
 |
| Q |
218 |
tggccgtgtctggtggtgacaacgatgatgcctccaaacaagacctctttcacctcatcaaacgctttggtgcttttgttactttcaagatcggtca |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37471115 |
tggccgtgtctggtggtgacaacgatgatgcctccaaactagacctctttcacctcatcaaacgctttggtgcttttgttactttcaagatcggtca |
37471019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University