View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_30 (Length: 331)
Name: NF4111_low_30
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_30 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 19 - 323
Target Start/End: Original strand, 42975354 - 42975661
Alignment:
| Q |
19 |
aaaagacattgttagtttgtttgttacaaagtcaactatggatgaaatttactcttagacgcgttgtcgagctcaactttcctaaatagnnnnnnnn--- |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42975354 |
aaaagacattgttagtttgtttgttacaaagtcaactatggatgaaatttactcttagacgcgttgtcgagctcaactttcctaaatagttttttttttt |
42975453 |
T |
 |
| Q |
116 |
aaagaactttcttattatcttagtgaagttttaatttttgatttcatataagaaaaaattcttctgaaattttccgcgtatagtttttcccccagttatc |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42975454 |
aaagaactctcttattatcttagtgaagttttaattttcgatttaatataagaaaaaattcttctgaaattttccgcgtatagtttttcccccagttatc |
42975553 |
T |
 |
| Q |
216 |
ggttaaatttaatatattagtttttagatgtagtttattcattcttctttatatttggccaattggccccctcgtaaaatttatgttagctccgtcattg |
315 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42975554 |
ggttaaacttaatatattagtttttagatgtagtttattcattcttctttatatttggccaattggccccctcgtaaaatttatgttagctccatcattg |
42975653 |
T |
 |
| Q |
316 |
tctgtgct |
323 |
Q |
| |
|
|||||||| |
|
|
| T |
42975654 |
tctgtgct |
42975661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University