View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_38 (Length: 273)
Name: NF4111_low_38
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 20097822 - 20097641
Alignment:
| Q |
17 |
cctctttccccgccaagccgctcgcgtccattctatggaagctgcctccctcctgtaatcctcgtgaaactggcgacgagatggtgatcgttggcgtccg |
116 |
Q |
| |
|
||||||||||||| ||| |||||| |||||||||||||||| |||||||||||||||||||||||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
20097822 |
cctctttccccgcgaagtcgctcgtgtccattctatggaagttgcctccctcctgtaatcctcgtgaaaccggcgacgagagggtgatcgttgtcgtcct |
20097723 |
T |
 |
| Q |
117 |
ctattggccgacgcg--------ttcaaacccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct |
190 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20097722 |
ctattggccgacgcggaacacacttcaaacccgcgatcctagtcgtcctcatgtgaacctgccgtaaccctaaccatatcct |
20097641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 209 - 262
Target Start/End: Complemental strand, 20097644 - 20097591
Alignment:
| Q |
209 |
tccttccgccgtgccgtttgctctccctttgcctgtcctaatcactatcttcat |
262 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
20097644 |
tccttctgccgtgctgtttgctctccctttgcttgtcctaatcactatcttcat |
20097591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University