View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_40 (Length: 254)
Name: NF4111_low_40
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_40 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 15 - 254
Target Start/End: Original strand, 43900950 - 43901189
Alignment:
| Q |
15 |
cagagaacattgcaatttattggggtcaaaataacaatgagggtaccctaacagaaacatgtgcaaaaggaaactacaacaactactcctatgtaatcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43900950 |
cagagaacattgcaatttattggggtcaaaataacaatgagggtaccctaacagaaacatgtgcaaaaggaaactacaacaactactcctatgtaatcat |
43901049 |
T |
 |
| Q |
115 |
agcttttcttaacaaatttgggaatggaacaacacctgaaatcaacttagcagatcattgtgacccttcttccaatgattgcacaatgttaagcacacac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901050 |
agcttttcttaacaaatttgggaatggaacaacacctgaaatcaacttagcagatcattgtgacccttcttccaatgattgcacaatgttaagcacacac |
43901149 |
T |
 |
| Q |
215 |
attaagaattgccaaatgaaaaggatcaaagtcttgcttt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901150 |
attaagaattgccaaatgaaaaggatcaaagtcttgcttt |
43901189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University