View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_48 (Length: 240)
Name: NF4111_low_48
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 105 - 232
Target Start/End: Complemental strand, 16288742 - 16288625
Alignment:
| Q |
105 |
acgttctgcatgaatatgtgatatctctctcttattgatcatacaatattggtttgttgttgctttcgtcgctgtcttgaacttcctaacaagtggtata |
204 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
16288742 |
acgttctgcatgaatatgtgatgtatctctcttat-gatcatacaatattggtttgttgttgctctc---------ttgaacttcctaacaagtggtata |
16288653 |
T |
|
| Q |
205 |
atagtctttgtttagcttggtgggggag |
232 |
Q |
| |
|
| |||||||||||||||||||||||||| |
|
|
| T |
16288652 |
agagtctttgtttagcttggtgggggag |
16288625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University