View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_51 (Length: 226)
Name: NF4111_low_51
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_51 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 43901313 - 43901524
Alignment:
| Q |
1 |
tattagatggtattgattttgatattgnnnnnnnctccaaaggaaaacaaaaccaacaacattgggaagaacttgcacgttttcttaagtcacgtaacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43901313 |
tattagatggtattgattttgatattgaaaaaaactccaaaggaaaacaaaaccaacaacattgggaagaacttgcacgttttcttaagtcacgtaacac |
43901412 |
T |
|
| Q |
101 |
ttcaacacaaaatgtttacttaagtgcagcacctcaatgtccata-cctgatggagaattaggtgtcgcacttgaaacgggcatttttgactatgtttgg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
43901413 |
ttcaacacaaaatgtttacttaagtgcagcacctcaatgtccataccctgatggagaattaggcgtcgcacttgaaacgggcgtttttgactatgtttgg |
43901512 |
T |
|
| Q |
200 |
atacagttttac |
211 |
Q |
| |
|
|||||||||||| |
|
|
| T |
43901513 |
atacagttttac |
43901524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University