View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_56 (Length: 213)
Name: NF4111_low_56
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_56 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 10 - 198
Target Start/End: Complemental strand, 781872 - 781684
Alignment:
| Q |
10 |
tgtcgaagaatataagatgaatacgagaaaattaaactagaagttactcttnnnnnnnnntcagcaagaattaattgcataatgtggatcttacaagtct |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
781872 |
tgtcgaagcatataagatgaatacgagaaaattaaactagaagttactcttaaaaaaaaatcagcaagaattaattgcataatgtggaccttacaagtct |
781773 |
T |
 |
| Q |
110 |
catacaaagtataagtatcgctaagatcacatcatatccgtttcacaataagaatgacaaatatttaccatatctactcttaaatattt |
198 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
781772 |
catacaaagtataagtattgccaagatcacatcatatccgtttcacaataagaatgacaaatatttaccatatctactcttaaatattt |
781684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University