View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4111_low_57 (Length: 213)
Name: NF4111_low_57
Description: NF4111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4111_low_57 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 22 - 180
Target Start/End: Complemental strand, 20596119 - 20595961
Alignment:
| Q |
22 |
cttactcccaccattttcctcttcctcttcactttcaggttcactctctaacacatcattgttatactcctcttcctcaactctgactatgctagattga |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20596119 |
cttactcccaccattttcctcttcctcttcactttcaggtccactctctaacatatcactgttatactcctcttcctcaactctgactatgctagattga |
20596020 |
T |
 |
| Q |
122 |
ccaacagtttggtttgtgttaatttgctcatccactacctcatcatcaaacacaggttc |
180 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20596019 |
ccaatagtttggtttgtgttaatttgctcatccactacctcatcatcaaacacaggttc |
20595961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 22 - 180
Target Start/End: Complemental strand, 8697118 - 8696960
Alignment:
| Q |
22 |
cttactcccaccattttcctcttcctcttcactttcaggttcactctctaacacatcattgttatactcctcttcctcaactctgactatgctagattga |
121 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8697118 |
cttattcccaccattttcctcttcatcttcactttcagctccactctctaacacatcactgttatactcctcttcctcaactctgactatgctagattga |
8697019 |
T |
 |
| Q |
122 |
ccaacagtttggtttgtgttaatttgctcatccactacctcatcatcaaacacaggttc |
180 |
Q |
| |
|
|||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8697018 |
ccaacattttggtttgtgttagtttgctcacccactacctcatcatcaaacacaggttc |
8696960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University