View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4112_high_15 (Length: 235)
Name: NF4112_high_15
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4112_high_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 49301587 - 49301367
Alignment:
| Q |
1 |
attgcggtatgaccgcgattaaaatgatggcataccttcaaattggaattcatgtattttgcttctttgtttaatttgatgattttttcgggagcatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301587 |
attgcggtatgaccgcgattaaaatgatggcataccttcaaattggaattcatgtattttgcttctttgtttaatttgatgattttttcgggagcatctt |
49301488 |
T |
|
| Q |
101 |
cttttattgcttgcttctcaataaaccaaggtgtaagttcatccctcacctcttctggcattttggagaggcgtcttgttttgctgttcatcatcaccca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49301487 |
cttttattgcttgcttctcaataaaccaaggtgtaagttcatccctcacctcttctggcattttggagaggcgtcttgttttgctgttcatcatcaccca |
49301388 |
T |
|
| Q |
201 |
tgtgctgttttatgtgtcaat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
49301387 |
tgtgctgttttatgtgtcaat |
49301367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University