View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4112_high_2 (Length: 457)
Name: NF4112_high_2
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4112_high_2 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 3e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 270 - 341
Target Start/End: Original strand, 42031532 - 42031603
Alignment:
| Q |
270 |
cttgtgttacagaacatttctctagaatggaaatatgagaatggatattttcatttttatattagtacatca |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42031532 |
cttgtgttacagaacatttctctagaatggaaatatgagaatggatgttttcatttttatattagtacatca |
42031603 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 408 - 457
Target Start/End: Original strand, 42031670 - 42031719
Alignment:
| Q |
408 |
cggatttacttcgacataaggtggtttctttgaaggtgtttttacttgct |
457 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
42031670 |
cggatttactttgacataagacggtttctttgaaggtgtctttacttgct |
42031719 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 38; Significance: 0.000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 87 - 188
Target Start/End: Original strand, 27910902 - 27911003
Alignment:
| Q |
87 |
atgatgtttggatctcttaatgggaaatcgattctgaagtctagaattgattttagcataagcaactccttgtagcttttgcatctaggtgaattgattc |
186 |
Q |
| |
|
||||||||||| ||||| || || |||| |||| ||||| ||||||||||||||| | |||| |||||||| ||||| ||| ||| |||||||||||| |
|
|
| T |
27910902 |
atgatgtttgggtctctgaagggaaaattgattatgaagcctagaattgattttactagaagctactccttggagcttctgcgtcttcgtgaattgattc |
27911001 |
T |
|
| Q |
187 |
ta |
188 |
Q |
| |
|
|| |
|
|
| T |
27911002 |
ta |
27911003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University