View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4112_high_6 (Length: 285)

Name: NF4112_high_6
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4112_high_6
NF4112_high_6
[»] chr3 (1 HSPs)
chr3 (214-270)||(10986088-10986144)


Alignment Details
Target: chr3 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 214 - 270
Target Start/End: Complemental strand, 10986144 - 10986088
Alignment:
214 tgacaaatacactgaaagtgagttaataattgacttgacattcgcagcagaagataa 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10986144 tgacaaatacactgaaagtgagttaataattgacttgacattcgcagcagaagataa 10986088  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University