View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4112_high_8 (Length: 255)
Name: NF4112_high_8
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4112_high_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 17 - 255
Target Start/End: Complemental strand, 50379924 - 50379686
Alignment:
| Q |
17 |
cctcccacggtgaatcccgcacaattcgcgcagcttatcctcaacagcattactgccaaatggtcatgaaatcctaccaattatgggaagaagctcaagc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50379924 |
cctcccacggtgaatcccgcacaattcgcgcagcttatcctcaacaacattactgccaaatggtcatgaaatcctaccaattatgggaagaagctcaagc |
50379825 |
T |
 |
| Q |
117 |
tcaagcaggcttcaatgtctattacaaagctcatcactttgacatgggttcttcaaacgatccaatgattctctctgtcttcgaaaactgccgccaaaac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50379824 |
tcaagcaggcttcaatgtctattacaaagctcatcactttgacatgggttcttcaaacgatccaatgattctctctgtcgtcgaaaactgccgccaaaac |
50379725 |
T |
 |
| Q |
217 |
aatctcccctgtcaactcctccgccgtgaacaagttgcc |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50379724 |
aatctcccctgtcaactcctccgccgtgaacaagttgcc |
50379686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University