View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4112_low_15 (Length: 250)
Name: NF4112_low_15
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4112_low_15 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 48660117 - 48659883
Alignment:
| Q |
16 |
ctgttgacatagctatgggaattcctccaatcaggagaacaagaaggttgttgattccatccctgtatgaacggtgctccacagggaacattataattat |
115 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660117 |
ctgttggcatagctatgggaattcctccaatcaggagaacaagaaggttgttgattccatccctgtatgaacggtgctccacagggaacattataattat |
48660018 |
T |
 |
| Q |
116 |
ttcaagaatcatccctatagctattgagcaaatgcagaagttaccaattgaggtaagaacctacagaaaagtaaacaattagatcacagtttaatatttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48660017 |
ttcaagaatcatccctatagctattgagcaaatgcagaagttgccaattgaggtaagaacctacagaaaagtaaacaattagatcacagtttaatatttg |
48659918 |
T |
 |
| Q |
216 |
agtggttaataaaaaacttcgcaaaaataatttta |
250 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
48659917 |
agtggttaataaaaaactttgcaaaaataatttta |
48659883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University