View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4112_low_17 (Length: 247)
Name: NF4112_low_17
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4112_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 15 - 231
Target Start/End: Complemental strand, 21098764 - 21098548
Alignment:
| Q |
15 |
caaaggtgatatatatagttgttggatggaagttgtagttataagaaaattgtggttgctgaagattctaagaaaattctcaaacggaatatcagtgtca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21098764 |
caaaggtgatatatatagttgttggatggaagttgtagttgtaagaaaattgtggttgctgaagattctaagaaaattctcaaacggaatatcagtgtca |
21098665 |
T |
|
| Q |
115 |
attttcgaaaatgctagcaacaatgtacaacaggtgagtttcctaatgagattattccaaaaaagtatctgtactatacttccatgtggataaggataac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21098664 |
attttcgaaaatgctagcaacaatgtacaacaggtgagtttcctaatgagattattccaaaaaagtatctgtactatacttccatgtggataaggataac |
21098565 |
T |
|
| Q |
215 |
acaaataggtaacactg |
231 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
21098564 |
acaaataggtaacactg |
21098548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University