View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4112_low_8 (Length: 285)
Name: NF4112_low_8
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4112_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 214 - 270
Target Start/End: Complemental strand, 10986144 - 10986088
Alignment:
| Q |
214 |
tgacaaatacactgaaagtgagttaataattgacttgacattcgcagcagaagataa |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10986144 |
tgacaaatacactgaaagtgagttaataattgacttgacattcgcagcagaagataa |
10986088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University