View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4112_low_9 (Length: 275)
Name: NF4112_low_9
Description: NF4112
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4112_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 20 - 270
Target Start/End: Complemental strand, 36126853 - 36126603
Alignment:
| Q |
20 |
tgctgtgatttgtaggtgtaaacctgatgctgagacatacaatgctcttattaatgcgcatggtcgagccggacaatggcgttgggctataaatattatg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
36126853 |
tgctgtgatttgtaggtgtaaacctgatgctgagacatacaatgctcttattaatgcgcatggtcgagccggacaatggcgttgggctatgaatattatg |
36126754 |
T |
 |
| Q |
120 |
gatgacatgctgcgtgcagctgtgtgtactttgtattttcttcccttatcaatcttcagtgacaccaaatttatgtgatcatcatttctttcttggtcgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
36126753 |
gatgacatgctgcgtgcagctgtgtgtactttgtattttcttcccttatcaatcttcagtgactccaaatttatgtgatcatcatttctttcttggtcgt |
36126654 |
T |
 |
| Q |
220 |
aattctagattgtagttgagcttgaaaacacaatatcatgcctatgcttct |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36126653 |
aattctagattgtagttgagcttgaaaacacaatatcatgcctgtgcttct |
36126603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University