View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4113_low_8 (Length: 213)
Name: NF4113_low_8
Description: NF4113
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4113_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 23876207 - 23876025
Alignment:
| Q |
19 |
acatatcctatagtgtaattattctcaggaatagatacaacctgcatcagagacaaa--gctcgtnnnnnnncggttaatatgtatgaaaatgttttacc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
23876207 |
acatatcctatagtgtaattattctcaggaatagatacaacctgcatcacagacaaaaagctcgtaagaaaacggttaatatgtatgaaaatgttttacc |
23876108 |
T |
 |
| Q |
117 |
aacaagtggctaaattgaataataatatcaacacttgccaagtagttcgctttcacaatttccactactgcagtcactctctg |
199 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
23876107 |
aacaggtggctaaattgaataataatatcaacacttgccaagtagctctctttcacaatttccactactgcagtcactgtctg |
23876025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University