View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4114_high_14 (Length: 354)
Name: NF4114_high_14
Description: NF4114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4114_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 311; Significance: 1e-175; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 311; E-Value: 1e-175
Query Start/End: Original strand, 14 - 340
Target Start/End: Original strand, 52846818 - 52847144
Alignment:
| Q |
14 |
agaattaactaaacaacgtgatctctttcaaaatttgctccaatcagttgggaaagatcaagttttaagagtagatcaagattgggcctcagaatggtca |
113 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52846818 |
agaattaactagacaacgtgatctctttcaaaatttgctccaatcagttgggaaagatcaagttttaagagtagatcaagattgggcctcagaatggtca |
52846917 |
T |
 |
| Q |
114 |
ggtgtttctaatgatcttagtccggttacaaatgtcattcctgagaatcttgacagaacaacatctggtgcgtctatttctaatgagaaccttttcaagc |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52846918 |
ggtgtttctaatgatcttagtccggttacaaatgtcattcctgagaatcttgacagaacaacatctggttcgtctatttctaatgagaaccttttcaagc |
52847017 |
T |
 |
| Q |
214 |
aacctgagtattctgaagacaactttctcttggacggttgtcctcccacatttgttgggcctgatccttgtcaaggttgggaggagatggctagcagatc |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52847018 |
aacctgagtattctgaagacaactttctcttggacggttgtcctccgacatttgttgggcccgatccttgtcaaggttgggaggagatggctagcagatc |
52847117 |
T |
 |
| Q |
314 |
tgaatttgaagatagcttcaaggaatt |
340 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
52847118 |
tgaatttgaagatagcttcaaggaatt |
52847144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University