View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4114_high_16 (Length: 316)
Name: NF4114_high_16
Description: NF4114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4114_high_16 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 283; Significance: 1e-158; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 18 - 316
Target Start/End: Original strand, 35228047 - 35228345
Alignment:
| Q |
18 |
taaacaattggataagtgggaaccatagcaattccacatgaaccttccttggcatgcacgtctctcttaatcttgatatatcctttctcaccccatttag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228047 |
taaacaattggataagtgggaaccatagcaattccacatgaaccttccttggcatgcacgtctctcttaatcttgatatatcctttctcaccccatttag |
35228146 |
T |
 |
| Q |
118 |
taccccatgaatttttcactagccaatacttcacaccatcatcactggtgccataaccaactatagtcactgtatgatctaaataaattccacattttcc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
35228147 |
taccccatgaatttttcactagccaatacttcacaccatcatcactggtaccataaccaactatagtaactgtatgatctaaatcaattccacattttcc |
35228246 |
T |
 |
| Q |
218 |
tttcaaaattccacttgagtaaaattgaaaagcgcgttttgtcgcggcaatataaaccgctataggttgatttgccaccgcttttaagagcgccttttc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35228247 |
tttcaaaattccacttgagtaaaattgaaaagcgcgttttgtcgcggcgatataaaccgctataggttgatttgccaccgcttttaagagcgccttttc |
35228345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 147
Target Start/End: Original strand, 31176467 - 31176515
Alignment:
| Q |
99 |
cctttctcaccccatttagtaccccatgaatttttcactagccaatact |
147 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||| |||||||| |
|
|
| T |
31176467 |
cctttctcaccccacccagtaccccatgaattttttactaaccaatact |
31176515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University