View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4114_high_28 (Length: 229)
Name: NF4114_high_28
Description: NF4114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4114_high_28 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 7887896 - 7888132
Alignment:
| Q |
1 |
caattcgtagttttttcatttgtttgtgttctgcttttcctttccgattcagttttcggttatcataataattgggtttctgctttttcctttctattag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7887896 |
caattcgtagttttttcatttgtttgtgttctgcttttcctttccgattcagttttcggttatcataataattgggtttctgctttttcctttctattag |
7887995 |
T |
 |
| Q |
101 |
ttagatttttgtttatgtgtttggattattattataatttatgaaaattccacactcgtaagctatgaaacacatacccaaacaccatataacacacta- |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
7887996 |
ttagatttttgtttatgtgtttggattattattataatttatgaaaattccacactcgtaagctatgaagcacatacacaaacaccatataacacactaa |
7888095 |
T |
 |
| Q |
200 |
-------actaattttgagaaactcgcataatttaat |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7888096 |
cacacatactaattttgagaaactcgcataatttaat |
7888132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University