View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4114_low_23 (Length: 261)
Name: NF4114_low_23
Description: NF4114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4114_low_23 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 17 - 108
Target Start/End: Original strand, 31217927 - 31218018
Alignment:
| Q |
17 |
aaattctaggctaactttatgttcttttggaagtttacaaatttttggcccacattttttagaagatttatgctggttacttggttagttac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31217927 |
aaattctaggctaactttatgttcttttagaagtttacaaatttttggcccacattttttagaagatttatgctggttacttggttagttac |
31218018 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University