View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_high_29 (Length: 303)
Name: NF4115_high_29
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_high_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 1 - 290
Target Start/End: Original strand, 9700145 - 9700434
Alignment:
| Q |
1 |
tccaaacaggcccttactcaagcatgtgatgggaattatatcattttttcacgccgcattgttatttttatatttttcaggcaactggaaacgtgcttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700145 |
tccaaacaggcccttactcaagcatgtgatgggaattatatcattttttcacgccgcattgttatttttatatttttcaggcaactggaaacgtgcttat |
9700244 |
T |
|
| Q |
101 |
gcagctgttaagcattttgttgaatgcctgatttctaattatgatcctaaaaagagacagatcaccaaaaggaatggtcttccaagtatcatattgtcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9700245 |
gcagctgttaagcattttgttgaatgcctgatttctaattatgatcctaaaaagagacagatcaccagaaggaatggtcttccaagtatcatattgtcag |
9700344 |
T |
|
| Q |
201 |
attatttagaaggccgtatgccaaaaagttcgcaagataagggatttaattggagtggggatgttgcgtcaatcacttcattttcacagg |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9700345 |
attatttagaaggccgtatgccaaaaagttcgcaagataagggatttaattggagtggggatgttgcgtcaatcacttcattttcacagg |
9700434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University