View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_high_33 (Length: 249)
Name: NF4115_high_33
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_high_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 13 - 149
Target Start/End: Complemental strand, 11019276 - 11019140
Alignment:
| Q |
13 |
cacaagtcatgtatgggaaaatgtcatagagctcacaccaataaatcagatcagattgatatataaaggtaacagagaaaagtttacattagcaacataa |
112 |
Q |
| |
|
|||||||||| || | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019276 |
cacaagtcatataagagaaaatgtcatagagctcacaccgataaatcagatcagattgatatataaaggtaacagagaaaagtttacattagcaacataa |
11019177 |
T |
 |
| Q |
113 |
ttaaaaatgcaaggtttgtaacatgttcagtgtgaca |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11019176 |
ttaaaaatgcaaggtttgtaacatgttcagtgtgaca |
11019140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 146 - 236
Target Start/End: Complemental strand, 11018966 - 11018876
Alignment:
| Q |
146 |
gacaattttactctccgctcttctcttttccactcttgttgaacgtcgttctcaacttcatccttctattttcttccaatgtttttcattt |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| || | |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11018966 |
gacaattttactctccgctcttctcttttccactctcgttgaatgttgctctcaacttcatccttctattttcttccaatgtttttcattt |
11018876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University