View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_high_37 (Length: 240)
Name: NF4115_high_37
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 30361024 - 30360797
Alignment:
| Q |
1 |
atttaaggcgcaaccagtattaaaagagtgagcaatcaagactttttttaagcatgcgtattttcttccaaagaaattttaacaaccaggacnnnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
30361024 |
atttaaggcgcaaccagtattaaaagagtgagcaatcaagactttttttaagcatgcgtattttcttcaaaagaaatttaaacaaccaggactttttttt |
30360925 |
T |
 |
| Q |
101 |
cttttcgaagcatgcatattttcaatgatgatacaagtagtgagcctaaatttcttttcatctgaatgtaccttgcagggacccaatcccagttccagag |
200 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360924 |
catttcgaagcatgcatattttcaatgatgatacaagtagtgagcctaaatttcttttcatctgaatgtaccttgcagggacccaatcccagttccagag |
30360825 |
T |
 |
| Q |
201 |
aaggtccgtaaaccccttacacaggttc |
228 |
Q |
| |
|
|||||||| ||||||||||||||||||| |
|
|
| T |
30360824 |
aaggtccgcaaaccccttacacaggttc |
30360797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 113; Significance: 2e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 103 - 223
Target Start/End: Complemental strand, 19916321 - 19916201
Alignment:
| Q |
103 |
tttcgaagcatgcatattttcaatgatgatacaagtagtgagcctaaatttcttttcatctgaatgtaccttgcagggacccaatcccagttccagagaa |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19916321 |
tttcgaagcatgcatattttcaatgatgatacaagtagtgagcctaaatttcttttcatatgaatgtaccttgcagggacccaatcccagttccagagaa |
19916222 |
T |
 |
| Q |
203 |
ggtccgtaaaccccttacaca |
223 |
Q |
| |
|
|||||| |||||||||||||| |
|
|
| T |
19916221 |
ggtccgcaaaccccttacaca |
19916201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University