View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_high_42 (Length: 231)
Name: NF4115_high_42
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_high_42 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 4e-71; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 76 - 231
Target Start/End: Original strand, 34415409 - 34415564
Alignment:
| Q |
76 |
tggcaagcacctgttgaaataatgataaggtgctgccttttgtcttattaggtacaagttgtcaggtattttaatttattttgagaggaagccaattctt |
175 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34415409 |
tggcaagctcctgttgaaataatgataaggtgctgccttttgtcttattaggtacaatttgtcaggtattttaatttattttgagaggaagccaattctt |
34415508 |
T |
 |
| Q |
176 |
ttattttattttgtcctcattctcttggtgtcgaaagtgttttccattttgtttac |
231 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
34415509 |
ttgttttattttgtcctcattctcttggtgtctaatgtgttttccattttgtttac |
34415564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 15277808 - 15277734
Alignment:
| Q |
1 |
attggtttgtcgttatgcacgctaaggttagagatgtatatgatttgggtgatcttcaatccaatgatatagata |
75 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15277808 |
attggtttgtcgttgtgcacgctaaggttagagatgtatatgatttgggtgatcttcaatccaatgctatagata |
15277734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 18153420 - 18153346
Alignment:
| Q |
1 |
attggtttgtcgttatgcacgctaaggttagagatgtatatgatttgggtgatcttcaatccaatgatatagata |
75 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18153420 |
attggtttgtcgttgtgcacgctaaggttagagatgtatatgatttgggtgatcttcaatccaatgctatagata |
18153346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 1 - 75
Target Start/End: Complemental strand, 12415410 - 12415336
Alignment:
| Q |
1 |
attggtttgtcgttatgcacgctaaggttagagatgtatatgatttgggtgatcttcaatccaatgatatagata |
75 |
Q |
| |
|
||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12415410 |
attggtttgtctttgttcacgctaaggttagagatgtatatgatttgggtgatcttcaatccaatgttatagata |
12415336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University