View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_high_9 (Length: 453)
Name: NF4115_high_9
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_high_9 |
 |  |
|
| [»] scaffold0288 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0288 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: scaffold0288
Description:
Target: scaffold0288; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 11411 - 11278
Alignment:
| Q |
1 |
tgaaattgtcaaggatgatgtgttcaatgcatttgataaggcaaatatttcgttggacaatgtgaattgagtgatgtttcttaattcatatctttttgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
11411 |
tgaaattgtcaaggatgatgtgttcaatgcattttataaggtaaatatttcgttggacaatgtgaattgagtgatgtttcttaattcatatcttttttt- |
11313 |
T |
 |
| Q |
101 |
atctctcttttgaaatcactaaataacacttagcag |
136 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| |
|
|
| T |
11312 |
-tctctcttttgaagtcactaaatagcacttagcag |
11278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University