View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4115_low_13 (Length: 453)

Name: NF4115_low_13
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4115_low_13
NF4115_low_13
[»] scaffold0288 (1 HSPs)
scaffold0288 (1-136)||(11278-11411)


Alignment Details
Target: scaffold0288 (Bit Score: 105; Significance: 3e-52; HSPs: 1)
Name: scaffold0288
Description:

Target: scaffold0288; HSP #1
Raw Score: 105; E-Value: 3e-52
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 11411 - 11278
Alignment:
1 tgaaattgtcaaggatgatgtgttcaatgcatttgataaggcaaatatttcgttggacaatgtgaattgagtgatgtttcttaattcatatctttttgtc 100  Q
    |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |     
11411 tgaaattgtcaaggatgatgtgttcaatgcattttataaggtaaatatttcgttggacaatgtgaattgagtgatgtttcttaattcatatcttttttt- 11313  T
101 atctctcttttgaaatcactaaataacacttagcag 136  Q
     ||||||||||||| |||||||||| ||||||||||    
11312 -tctctcttttgaagtcactaaatagcacttagcag 11278  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University