View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_low_20 (Length: 389)
Name: NF4115_low_20
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 124 - 378
Target Start/End: Complemental strand, 6300182 - 6299928
Alignment:
| Q |
124 |
caggatattttgaaagcaatttcatcgagacaaaagtgggatttaaacgatgttcgagttttcaacttcgatgttgctaaaatcagattcggaacttctc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6300182 |
caggatattttgaaagcaatttcatcgagacaaaagtgggatttaaacgatgttcgagttttcaacttcgatgttgctaaaatcagattcggaacttctc |
6300083 |
T |
 |
| Q |
224 |
aaaactaccaatttcgaatcggctcgagtaagaacaatttcaccgtcaaattttcagatgaaatttcatcttggaatcacaacaagttcacaacaacacc |
323 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6300082 |
aaaactacctatttcgaatcggctcgagtaagaacaatttcaccgtcaaattttcagatgaaatttcatcttggaatcacaacaagttcacaacaacacc |
6299983 |
T |
 |
| Q |
324 |
aaaaccagatttagcttctcttgttgatcaactcagttctattgcttttcttgat |
378 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299982 |
aaaaccagatttagcttctcttgttgatcaactcagttctattgcttttcttgat |
6299928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University