View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_low_43 (Length: 243)
Name: NF4115_low_43
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_low_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 13 - 226
Target Start/End: Complemental strand, 44994916 - 44994703
Alignment:
| Q |
13 |
gatccattatttctacctcatgtttggtacaacatttttgagatcttgtctattgtaattcttatgtgatccctactctctagctcggattttaacctta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44994916 |
gatccattatttctacctcatgtttggtacaccatttttgagatcttgtctattgtaattcttatgtgatccctactctctagctcggattttaacctta |
44994817 |
T |
 |
| Q |
113 |
aaatgtctcactagattaaagaaagtgtgtttagaaggtattctaacccttgattcctaattctcattcaagggacctgattattggactcttcgtatct |
212 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44994816 |
aaatgtctcactagattaaagaaagtatgtttagaaggtattctaacccttgattcctaattctcattcaagggacctgattattggactcttcgtatct |
44994717 |
T |
 |
| Q |
213 |
attcattatgttca |
226 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
44994716 |
attcattatgttca |
44994703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University