View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_low_52 (Length: 228)
Name: NF4115_low_52
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_low_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 34415568 - 34415779
Alignment:
| Q |
1 |
taattgttcattttgtgtttatactgacatttcgacacattattatgctgccgtgatttatatgtgctggttttaaaatttacagttactaatcnnnnnn |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34415568 |
taattgttcattttgtgtttatactgacatttcggcacattattatgctgccgtgatttatctgtgctggttttaaaatttacagttactaatctttttt |
34415667 |
T |
|
| Q |
101 |
nctttctacattgtccaggctattaaagtagttaatttagatcaaaagactaaaatggttacggagctggatggtcatattatgcgatgcgtgcgtgatc |
200 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34415668 |
tctttctacattgtccaggctattgaagtagttaatttagatcaaaagactaaaatggttacggagctggatggtcatattatgcgatgcgtgcgtgatc |
34415767 |
T |
|
| Q |
201 |
agaatggaaacc |
212 |
Q |
| |
|
|||||||||||| |
|
|
| T |
34415768 |
agaatggaaacc |
34415779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 106 - 212
Target Start/End: Complemental strand, 155801 - 155696
Alignment:
| Q |
106 |
ctacattgtccag-gctattaaagtagttaatttagatcaaaagactaaaatggttacggagctggatggtcatattatgcgatgcgtgcgtgatcagaa |
204 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| | |||||||||| |
|
|
| T |
155801 |
ctacattgtccagcgctattaaaatagttaatttagatcaaaagac--aaatggttacggagcttgatggtcatattatgcgatgcgcgtgtgatcagaa |
155704 |
T |
|
| Q |
205 |
tggaaacc |
212 |
Q |
| |
|
|||||||| |
|
|
| T |
155703 |
tggaaacc |
155696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University