View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4115_low_6 (Length: 648)
Name: NF4115_low_6
Description: NF4115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4115_low_6 |
 |  |
|
| [»] chr2 (92 HSPs) |
 |  |
|
| [»] chr5 (80 HSPs) |
 |  |
|
| [»] chr4 (118 HSPs) |
 |  |
|
| [»] chr1 (109 HSPs) |
 |  |
|
| [»] chr7 (94 HSPs) |
 |  |
|
| [»] chr8 (85 HSPs) |
 |  |
|
| [»] chr6 (70 HSPs) |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0025 (1 HSPs) |
 |  |
|
| [»] scaffold1127 (1 HSPs) |
 |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |
|
| [»] scaffold0038 (1 HSPs) |
 |  |  |
|
| [»] scaffold0016 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |
|
| [»] scaffold0011 (2 HSPs) |
 |  |
|
| [»] scaffold0071 (1 HSPs) |
 |  |  |
|
| [»] scaffold0028 (1 HSPs) |
 |  |  |
|
| [»] scaffold1619 (1 HSPs) |
 |  |  |
|
| [»] scaffold1149 (1 HSPs) |
 |  |
|
| [»] scaffold0122 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
| [»] scaffold1120 (1 HSPs) |
 |  |
|
| [»] scaffold0735 (1 HSPs) |
 |  |
|
| [»] scaffold0262 (1 HSPs) |
 |  |
|
| [»] scaffold0259 (1 HSPs) |
 |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |
|
| [»] scaffold0143 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 363; Significance: 0; HSPs: 96)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 1 - 427
Target Start/End: Complemental strand, 34899760 - 34899335
Alignment:
| Q |
1 |
gatgatatcactgacaatatgataatttggtatctcttgcctatcttattataacatttgcatatgcttgtgtggtacgttacgcataaaaaccaagtgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34899760 |
gatgatatcactgacaatatgataatttggtatctcttgcctatcttattataacatttgcatatgcttgtgtggtac-ttacgcataaaaaccaagtgg |
34899662 |
T |
 |
| Q |
101 |
aacatgtcaactgacccactaattgaggttctcctaataactaagaacatttttagagacacattttcgatattcaattttctgcattcagctaccaact |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899661 |
aacatgtcaactgacccactagttgaggttctcctaataactaagaacatttttagagacacattttcgatattcaattttctgcattcagctaccaact |
34899562 |
T |
 |
| Q |
201 |
aattatttgtaagtcttagcagacacttcttcatagannnnnnnngttgaagaagtcaaaaattatattaaacgaaaaagagatcccaataaatacaagt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34899561 |
aattatttgtaagtcttagcagacacttcttcatagattttttttgttgaagaagtcaaaaattatattaaacgaaaaagagatcccaataaatacaagt |
34899462 |
T |
 |
| Q |
301 |
tgagtttaagaaggatccaaatagcaccacaagaaacaattagagaagtgtcaaaacaaaagggnnnnnnnnttcattgatgaattgtatagccctgatt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34899461 |
tgagtttaagaaggatccaaatagcaccacaagaaacaattagagaagtgtcaaaacaaaagggaaaaaaaattcattgatgaattgtatagccctgatt |
34899362 |
T |
 |
| Q |
401 |
tttaaaattgagcaagactcttctgat |
427 |
Q |
| |
|
|||| |||||||||||||||||||||| |
|
|
| T |
34899361 |
tttagaattgagcaagactcttctgat |
34899335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 132; E-Value: 3e-68
Query Start/End: Original strand, 468 - 647
Target Start/End: Complemental strand, 34899294 - 34899115
Alignment:
| Q |
468 |
tactataataactagttttttacaaggttaaaataaacgtatctgtaaacttatgttgaaattttacaaatgtagagccattttatttttattaaacgat |
567 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34899294 |
tactataataaccagttttttacgaggttaaaataaacgtatctgtaaacttatgttgaaattttataaatgtagaaccattctatttttattaaacgat |
34899195 |
T |
 |
| Q |
568 |
gttcggcaactatgtgannnnnnnngttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34899194 |
gttcggcaactatgtgattttttttgttggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctac |
34899115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 7464482 - 7464535
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
7464482 |
tggtggtcggggtttgaaccccggaccttacatatattatgcattgtccctacc |
7464535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 10922299 - 10922352
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10922299 |
tggtagtcggggtttgaaccccggatcttgcatatattatgcattgtccctacc |
10922352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 38130950 - 38131003
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
38130950 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
38131003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 45432018 - 45431965
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45432018 |
tggtggccagggtttgaaccccggaccttgcatatattatgcattgtccctacc |
45431965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 25727958 - 25728006
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25727958 |
tggtggtcgggatttgaaccccggaccttgcatatattatgcattgtcc |
25728006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 48849754 - 48849801
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48849754 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
48849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 597 - 646
Target Start/End: Original strand, 1111834 - 1111883
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
1111834 |
gtggtcggggtttgaaccccagaccttgcatatattatgtattgtcccta |
1111883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 25340915 - 25340968
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
25340915 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgtccatacc |
25340968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 25441491 - 25441544
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
25441491 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgtccatacc |
25441544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 27185547 - 27185494
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
27185547 |
tggtggtcgaggtttgaaccccagaccttgcatatattatgtattgtccctacc |
27185494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 39779094 - 39779041
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
39779094 |
tggtggttggggtttgaaccccgaaccttgcatatattatgcattgtccatacc |
39779041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 4601914 - 4601866
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
4601914 |
tggtggccggggtttgaaccccggaccttgcatttattatgcattgtcc |
4601866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 606 - 646
Target Start/End: Complemental strand, 32753887 - 32753847
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32753887 |
gtttgaaccccgggccttgtatatattatgcattgtcccta |
32753847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 604 - 643
Target Start/End: Complemental strand, 41817560 - 41817521
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
41817560 |
gggtttgaaccccggaccttgcatatattatgcattgtcc |
41817521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 48315017 - 48315068
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
48315017 |
gtggtcgggatttgaaccccggaccttgcatatattatgcattatccttacc |
48315068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 7738732 - 7738686
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
7738732 |
cggggcttgaaccccggaccttgcatattttatgcattgtccctacc |
7738686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 645
Target Start/End: Complemental strand, 8238634 - 8238584
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
|||||| ||| ||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
8238634 |
tggtggccggagtttgaaccccagaccttgcatatattatgcattgtccct |
8238584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 22722472 - 22722426
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||| ||||||||||| |
|
|
| T |
22722472 |
tggtggtcggggtttgaacctcggaccttgcatattttatgcattgt |
22722426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 45334259 - 45334213
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
45334259 |
tggtggtcgggatttgaaccccgaaccttgcatatattatgcattgt |
45334213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 598 - 648
Target Start/End: Original strand, 49082703 - 49082753
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| || |||||||| |||| |
|
|
| T |
49082703 |
tggtcggggtttgaaccccggaccttgcatatatcatacattgtccatacc |
49082753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 599 - 648
Target Start/End: Complemental strand, 552240 - 552191
Alignment:
| Q |
599 |
ggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| || |||||||||||||||||| | |||||||| |
|
|
| T |
552240 |
ggtcggggtttgaaccctggaccttgcatatattatgcaatatccctacc |
552191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 3755409 - 3755356
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || ||||| ||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
3755409 |
tggtggccgaggtttaaaccctggaccttgcatatattatgcattgtccctacc |
3755356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 8136623 - 8136676
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||||||||| |||| |||| |
|
|
| T |
8136623 |
tggtggtcggggtttgaaccttggaccttgcatatattatgcatcgtccatacc |
8136676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 11358304 - 11358251
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||| |||||| ||||| |
|
|
| T |
11358304 |
tggtggccggggtttgaaccccggatcttgcatatattatgaattgtcgctacc |
11358251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 14030726 - 14030779
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||||||||| |
|
|
| T |
14030726 |
tggtggtcggggtttgaactccaaaccttgcatatattatgcgttgtccctacc |
14030779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29631256 - 29631203
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
29631256 |
tggtggccggggtttgaatcccgaaccttgcatatattatgcattgtccatacc |
29631203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 48022305 - 48022358
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
48022305 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgtctctacc |
48022358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 605 - 642
Target Start/End: Original strand, 48656900 - 48656937
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48656900 |
ggtttgaaccccggaccttgcatatattatgcattgtc |
48656937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 51882191 - 51882244
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
51882191 |
tggtggccggggtttgaaccctggatcttgcatatattatgcattgtccatacc |
51882244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 52119446 - 52119393
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| |||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
52119446 |
tggtggccggggttcgaaccccgaaccttgcatatattatgcattgtccttacc |
52119393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 334838 - 334882
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||| |
|
|
| T |
334838 |
tggtggccggggtttgaaccccggaccttgcatattttatgcatt |
334882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 916509 - 916461
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
916509 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
916461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 16663236 - 16663280
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
16663236 |
gggtttgaaccccggaccttgcatatattatgcattatccatacc |
16663280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 602 - 642
Target Start/End: Original strand, 16792972 - 16793012
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
16792972 |
cggggtttgaaccctggaccttgcatatattatgcattgtc |
16793012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 32843253 - 32843301
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
32843253 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgtcc |
32843301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 44075147 - 44075195
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
44075147 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
44075195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 594 - 642
Target Start/End: Original strand, 46226015 - 46226063
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||| |||||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
46226015 |
ttggtgttcggggttcgaactccggaccttgcatatattatgcattgtc |
46226063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 48796209 - 48796257
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
48796209 |
tggtggccggggtttgaaccccgaaccttgcatatcttatgcattgtcc |
48796257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 640
Target Start/End: Original strand, 913601 - 913636
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattg |
640 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
913601 |
ggtttgaaccccggaccttgcatatattatgcattg |
913636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Complemental strand, 8075855 - 8075808
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||| ||||||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
8075855 |
tggtggccggggtttgaacctcagaccttgcatatattatgcattgtc |
8075808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 603 - 646
Target Start/End: Original strand, 13829076 - 13829119
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||| ||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
13829076 |
ggggttcgaaccccagaccttgcatatattatgcattgtcccta |
13829119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 644
Target Start/End: Original strand, 34442440 - 34442487
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
34442440 |
gtggccggggtttgaaccccggaccttacatattttatgcattgtccc |
34442487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 607 - 642
Target Start/End: Original strand, 40575612 - 40575647
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
40575612 |
tttgaaccccggaccttgcatatattatgcattgtc |
40575647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 613 - 648
Target Start/End: Complemental strand, 48511302 - 48511267
Alignment:
| Q |
613 |
ccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48511302 |
ccccggaccttgcatatattatgcattgtccctacc |
48511267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 986946 - 986992
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||| || |||||||||| |||| |||||||| |
|
|
| T |
986946 |
gtggtcggggtttgaaccctggaccttgcatattttatacattgtcc |
986992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 598 - 648
Target Start/End: Original strand, 2186421 - 2186471
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| | |||| ||||||||||| ||||||| |||| |
|
|
| T |
2186421 |
tggtcggggtttgaaccccagaccttacatatattatgtattgtccatacc |
2186471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 639
Target Start/End: Original strand, 4332660 - 4332702
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
4332660 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
4332702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 4825409 - 4825363
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||| |||| ||||||||| |||| ||||||||||||||||| |
|
|
| T |
4825409 |
tggtggtcgaggttcgaaccccggacctttcatatattatgcattgt |
4825363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 11508476 - 11508522
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||||| ||||||||||| |
|
|
| T |
11508476 |
gtggtcggggttcgaaccccggaccctgcatatatcatgcattgtcc |
11508522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 17218554 - 17218508
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| ||||||||||| |||||| | |||||||| |
|
|
| T |
17218554 |
cggggtttgaaccccggcccttgcatataatatgcaatatccctacc |
17218508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 598 - 648
Target Start/End: Complemental strand, 21245860 - 21245810
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||| | |||| ||||||||||||||||||| |||| |
|
|
| T |
21245860 |
tggtcgaggtttgaaccccagaccttacatatattatgcattgtccttacc |
21245810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 24145466 - 24145415
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||||||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
24145466 |
tggtgatcggggtttgaacc--ggaccttgtatatattatgcattgtccctacc |
24145415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 28244095 - 28244141
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||| |||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
28244095 |
tggtgatcggggttcgaaccccggaccttgcatattttatgcattgt |
28244141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 610 - 648
Target Start/End: Complemental strand, 28266771 - 28266733
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
28266771 |
gaaccccggaccttgcatatattatgcattgtccttacc |
28266733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 598 - 648
Target Start/End: Original strand, 30554869 - 30554919
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| | ||||||||||| |||||||||||| |||| |
|
|
| T |
30554869 |
tggtcggggtttgaaccctgaaccttgcatatagtatgcattgtccatacc |
30554919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 639
Target Start/End: Original strand, 35347288 - 35347330
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||| |||||||||||| | |||||||||||||||||||| |
|
|
| T |
35347288 |
gtggtcgaggtttgaaccccagaccttgcatatattatgcatt |
35347330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 645
Target Start/End: Complemental strand, 36483746 - 36483696
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
|||||| ||||||| |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
36483746 |
tggtggccggggttcgaacccaaggccttgtatatattatgcattgtccct |
36483696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 44579699 - 44579653
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
44579699 |
cggggttcgaaccccggaccttgcatattttatgcattgtccatacc |
44579653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 614 - 648
Target Start/End: Original strand, 46226087 - 46226121
Alignment:
| Q |
614 |
cccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46226087 |
cccggaccttgcatatattatgcattgtccctacc |
46226121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 648
Target Start/End: Original strand, 47536482 - 47536524
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
47536482 |
gtttgaacctcggaccttgcatattttatgcattgtccctacc |
47536524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 51047160 - 51047214
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcata-tattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||| |||||| |||||||| |||| |
|
|
| T |
51047160 |
tggtggtcggggtttgaaccccggaccttacatattattatacattgtccatacc |
51047214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 52904141 - 52904187
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| | | |||||||||||||||||||||| |||| |
|
|
| T |
52904141 |
cggggtttgaacccccgacattgcatatattatgcattgtccttacc |
52904187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 607 - 648
Target Start/End: Original strand, 977944 - 977985
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
977944 |
tttgaactccggaccttgcatatattatgcattgtccatacc |
977985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 615 - 648
Target Start/End: Complemental strand, 4564659 - 4564626
Alignment:
| Q |
615 |
ccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
4564659 |
ccggaccttgcatatattatgcattgtccctacc |
4564626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 5349598 - 5349545
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| | ||||||||||| ||| |||||||||||| ||||||||||| |||| |
|
|
| T |
5349598 |
tggtggccagggtttgaacctcggaccttgcatatataatgcattgtccttacc |
5349545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 10102869 - 10102816
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
10102869 |
tggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctacc |
10102816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 10213792 - 10213739
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||| || |||||| |||||||||||||||||||| |
|
|
| T |
10213792 |
tggtggccggggtttgaaccctggattttgcatgtattatgcattgtccctacc |
10213739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 607 - 648
Target Start/End: Complemental strand, 10926527 - 10926486
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
10926527 |
tttgaaccccgaaccttgcatatattatgcattgtccttacc |
10926486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 14827595 - 14827542
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||| |||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
14827595 |
tggtggccggggtttaaaccccggatcttgcatattttatgcattgtccatacc |
14827542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 18870716 - 18870769
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||| | || ||||||||||||||||||||||||||||| |
|
|
| T |
18870716 |
tggtggccgaggtttgaatcatggaccttgcatatattatgcattgtccctacc |
18870769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 23147969 - 23148022
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||||| ||||||||| ||| |||||||||||| ||||||| |||| |
|
|
| T |
23147969 |
tggtgttcggggttcgaaccccggacctcgcatatattatgtattgtccttacc |
23148022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 644
Target Start/End: Original strand, 27065731 - 27065772
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
||||||||||||| || |||||||||| |||||||||||||| |
|
|
| T |
27065731 |
ggggtttgaaccctggaccttgcatattttatgcattgtccc |
27065772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 32629150 - 32629097
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| ||| ||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
32629150 |
tggtggtcgatgttcgaaccccggaccttgcatattttatgcattgtccatacc |
32629097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 35191816 - 35191861
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
35191816 |
ggggttcgaaccccagaccttgcatatattatgcattgtccttacc |
35191861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 35863804 - 35863857
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||| | |||||||||||||||| ||||||| |||| |
|
|
| T |
35863804 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccttacc |
35863857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 42401502 - 42401449
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| |||| |||||||||| | | ||||||||||| ||||||||||||||||| |
|
|
| T |
42401502 |
tggttgtcgcggtttgaaccgcagaccttgcatatactatgcattgtccctacc |
42401449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 643
Target Start/End: Original strand, 49975807 - 49975844
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
49975807 |
gtttgaaccccagaccttgcatatattatgcattgtcc |
49975844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 51250224 - 51250277
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||||||||||||| | ||||||||||||||||| |||||||| |||| |
|
|
| T |
51250224 |
tggtgatcggggtttgaacttcaggccttgcatatattatacattgtccttacc |
51250277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 636
Target Start/End: Original strand, 51812576 - 51812617
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgc |
636 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
51812576 |
tggtggtcgtggtttgaaccccgtaccttgcatatattatgc |
51812617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 53996369 - 53996316
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
53996369 |
tggtggccgggattcgaaccccagaccttgcatatattatgcattgtccatacc |
53996316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 2153492 - 2153540
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| | |||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
2153492 |
tggtggccagggtttaaaccccagaccttgcatatattatgcattgtcc |
2153540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 606 - 642
Target Start/End: Original strand, 7626463 - 7626499
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
7626463 |
gtttgaaccccggaccttgcatattttatgcattgtc |
7626499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 20296364 - 20296316
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||| |||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
20296364 |
tggtcgtcggggtttgaacatcggactttgcatatattatgcattgtcc |
20296316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 597 - 641
Target Start/End: Original strand, 20612270 - 20612314
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20612270 |
gtggccggggtttgaaccccaaaccttgcatatattatgcattgt |
20612314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 22251451 - 22251495
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| ||||||| ||||||||| || ||||||||||||||||| |
|
|
| T |
22251451 |
tggtggccggggttcgaaccccggaccgtgcatatattatgcatt |
22251495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 22799717 - 22799765
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||| | ||||||||||||| |
|
|
| T |
22799717 |
tggtggtcgaggtttgaacctcggaccttgcatgttttatgcattgtcc |
22799765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 597 - 641
Target Start/End: Complemental strand, 24348455 - 24348411
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||| ||||||||| | | |||||||||||||||||||||| |
|
|
| T |
24348455 |
gtggtcggagtttgaacctctgaccttgcatatattatgcattgt |
24348411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 24428473 - 24428517
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| ||| | |||||||||||||||||||||| |||| |
|
|
| T |
24428473 |
gggtttgaacctcggactttgcatatattatgcattgtccatacc |
24428517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 611 - 643
Target Start/End: Original strand, 25961229 - 25961261
Alignment:
| Q |
611 |
aaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
25961229 |
aaccccgggccttgcatatattatacattgtcc |
25961261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 29164744 - 29164788
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||||||||||||||| | | ||||||||||||| |||| |
|
|
| T |
29164744 |
tggtggtcggggtttgaaccccagactttgcatatattatacatt |
29164788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 31214704 - 31214660
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||| ||||||| ||||| |||| ||||||||||||||| |
|
|
| T |
31214704 |
tggtggtcggagtttgaatcccggaccttacatatattatgcatt |
31214660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 32909292 - 32909340
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||| ||||||||| || |||||||||| ||||||||||||| |
|
|
| T |
32909292 |
tggtggccgggatttgaacccaggaccttgcatattttatgcattgtcc |
32909340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 603 - 643
Target Start/End: Complemental strand, 33745161 - 33745121
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
33745161 |
ggggtttgaaccccagaccttgcatattttatgcattgtcc |
33745121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 47039497 - 47039449
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| || |||||||| | |||||||||||||||||||||| |
|
|
| T |
47039497 |
tggtggtcgggattcgaaccccgaactttgcatatattatgcattgtcc |
47039449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 50; Significance: 3e-19; HSPs: 92)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 3e-19
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 31815878 - 31815931
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31815878 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccctacc |
31815931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 20565066 - 20565119
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20565066 |
tggtggttggggtttgaaccccggaccttgcatatattatgcattgtccctacc |
20565119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29544697 - 29544644
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29544697 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtccctacc |
29544644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 594 - 648
Target Start/End: Original strand, 660812 - 660866
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
660812 |
ttggtggtcggggtttgaaccctggaccttgcatatattatgcattgtccatacc |
660866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 10735822 - 10735875
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
10735822 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatcgtccctacc |
10735875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 24592837 - 24592890
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
24592837 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctacc |
24592890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 8781643 - 8781694
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
8781643 |
gtggtcggggtttgaaccccggaccttgcatacattatgcattgtccatacc |
8781694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 23250311 - 23250357
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
23250311 |
tggtggtcggggtttgaaccctggaccttgcatatattatgcattgt |
23250357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 597 - 643
Target Start/End: Complemental strand, 42791363 - 42791317
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42791363 |
gtggccggggtttgaaccccggaccttgcatatattatgcattgtcc |
42791317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 598 - 643
Target Start/End: Complemental strand, 29734758 - 29734713
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29734758 |
tggtcggggtttgaaccacggaccttgcatatattatgcattgtcc |
29734713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 30089119 - 30089066
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
30089119 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctacc |
30089066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 30125723 - 30125670
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
30125723 |
tggtggccgaggtttgaaccccggaccttgtatatattatgcattgtccctacc |
30125670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 31543082 - 31543029
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
31543082 |
tggtggttggggtttgaaccccggaccttgcatatattatgcattatccatacc |
31543029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 35820292 - 35820345
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
35820292 |
tggtggccgaggtttgaaccccggaccttgcatgtattatgcattgtccctacc |
35820345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 9547400 - 9547448
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9547400 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcattgtcc |
9547448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 23407009 - 23407057
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
23407009 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcattgtcc |
23407057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 603 - 643
Target Start/End: Original strand, 25186241 - 25186281
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25186241 |
ggggtttgaaccccggaccttgcatatattatgcattgtcc |
25186281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 25612284 - 25612332
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
25612284 |
tggtggtcgggggttgaatcccggaccttgcatatattatgcattgtcc |
25612332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 27848228 - 27848184
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27848228 |
tggtggccggggtttgaaccccggaccttgcatatattatgcatt |
27848184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 602 - 642
Target Start/End: Complemental strand, 44694751 - 44694711
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44694751 |
cggggtttgaaccccgagccttgcatatattatgcattgtc |
44694711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 597 - 644
Target Start/End: Complemental strand, 4180765 - 4180718
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
4180765 |
gtggtcggggtttgaaccccggaccttgcatattttatgcattatccc |
4180718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 595 - 646
Target Start/End: Original strand, 5168570 - 5168621
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
5168570 |
tggtagtcggggtttgaaccccgaaccttgcatatattatgcattatcccta |
5168621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 8091151 - 8091202
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8091151 |
gtggtcgatgtttgaaccccggaccttgcatatattatgcattgtccatacc |
8091202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 4927447 - 4927493
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||| ||||||||||| |
|
|
| T |
4927447 |
cggggtttgaaccccggaccttacatatattatgctttgtccctacc |
4927493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 11560561 - 11560515
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
11560561 |
cggggtttgaaccctgaaccttgcatatattatgcattgtccctacc |
11560515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 18693655 - 18693701
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
18693655 |
gtggtcggggtttgaaccctggatcttgcatatattatgcattgtcc |
18693701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 20200775 - 20200729
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
20200775 |
tggtggccggggtttgaaccctggaccttgcatatattatgcattgt |
20200729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 24581008 - 24581054
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
24581008 |
tggtggtcggggtttgaacctcgaaccttgcatatattatgcattgt |
24581054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 29896285 - 29896331
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29896285 |
tggtggtcggggtttgaaccccaaaccttgcatatattatgcattgt |
29896331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 605 - 643
Target Start/End: Complemental strand, 36359374 - 36359336
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36359374 |
ggtttgaaccccggaccttgcatatattatgcattgtcc |
36359336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 44526199 - 44526145
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||||| ||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
44526199 |
ttggtggccggggtttgaatcccggaccttgcgtatattatgcattgtccatacc |
44526145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 2257041 - 2256988
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
2257041 |
tggtggccggggttcgaaccccagaccttgcatatattatgcattgtccatacc |
2256988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 3197071 - 3197123
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||||||||||||||| |
|
|
| T |
3197071 |
tggtggtcggggtttgaatcc-gaaccttgcatatattatgcattgtccctacc |
3197123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 4138061 - 4138008
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| | ||| ||||||||||||||| |||||||| |||| |
|
|
| T |
4138061 |
tggtggtcggggtttgaatctcggaccttgcatatattatacattgtccttacc |
4138008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 20455961 - 20455908
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20455961 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattgtccatacc |
20455908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 597 - 642
Target Start/End: Complemental strand, 22709153 - 22709108
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
22709153 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgtc |
22709108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 24593446 - 24593393
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| || ||||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
24593446 |
tggtgttcagggttcgaaccccggaccttgcatatattatgcattgtccttacc |
24593393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 34977274 - 34977221
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||| ||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
34977274 |
tggtggccggggtttaaactccggaccttgcatatattatgcattgtccatacc |
34977221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 36264470 - 36264523
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||| ||| |||| |
|
|
| T |
36264470 |
tggtggtcggggtttgaaccccgaactttgcatatattatgcattatccatacc |
36264523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 597 - 638
Target Start/End: Original strand, 40853811 - 40853852
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcat |
638 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
40853811 |
gtggtcggggtttgatccccggaccttgcatatattatgcat |
40853852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 41859922 - 41859869
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||| ||||||||||||| |||| |
|
|
| T |
41859922 |
tggtggccggggtttgaaccccagaccttgcatattttatgcattgtccatacc |
41859869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 3708763 - 3708715
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
3708763 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
3708715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 11868653 - 11868701
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
11868653 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
11868701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 12599856 - 12599904
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||||||| ||||||| |
|
|
| T |
12599856 |
tggtggtcggggttcgaaccccagaccttgcatatattatgtattgtcc |
12599904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 25625786 - 25625738
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| ||||||||||||||| |||| ||||||||||| ||||||| |
|
|
| T |
25625786 |
tggtggtccgggtttgaaccccggaccttacatatattatgaattgtcc |
25625738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 598 - 646
Target Start/End: Complemental strand, 27244724 - 27244676
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
27244724 |
tggtcgggctttgaaccctagaccttgcatatattatgcattgtcccta |
27244676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 35360046 - 35360094
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
35360046 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
35360094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 43043155 - 43043203
Alignment:
| Q |
595 |
tggtggtcgggg-tttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
43043155 |
tggtggtcgggggtttgaaccccggaccttgcatacattatgcattgtc |
43043203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 4557762 - 4557809
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||| ||||||||||| ||| |||| |||||||||||||||||| |
|
|
| T |
4557762 |
tggtggtcagggtttgaaccacggaccttacatatattatgcattgtc |
4557809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Complemental strand, 12124605 - 12124562
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
12124605 |
ggttcgaaccccggaccttgcatatattatgcattgtccttacc |
12124562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 20990895 - 20990942
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| |||||||||||| |
|
|
| T |
20990895 |
tggtggtcggggtttgaaccctgaaccttgcatattttatgcattgtc |
20990942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 607 - 646
Target Start/End: Complemental strand, 36474820 - 36474781
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
36474820 |
tttgaaccccggaccttgcatattttatgcattgtcccta |
36474781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 639
Target Start/End: Original strand, 346117 - 346159
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
346117 |
gtggtcggggtttgaaccctggaccttacatatattatgcatt |
346159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 604 - 646
Target Start/End: Complemental strand, 3904263 - 3904221
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||| | |||| |||||||||||||||||||||| |
|
|
| T |
3904263 |
gggtttgaaccccagaccttacatatattatgcattgtcccta |
3904221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 7206188 - 7206142
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| |||| ||| ||||||||||||||||||||||| ||||| |
|
|
| T |
7206188 |
cggggtttaaacctcggaccttgcatatattatgcattgtctctacc |
7206142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 20120719 - 20120765
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20120719 |
cgggatttgaaccccgaaccttgcatatattatgcattgtccttacc |
20120765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 21870886 - 21870940
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcata-tattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
21870886 |
tggtggtcggggttcgaaccccgaaccttgcatattattatgcattgtccatacc |
21870940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 637
Target Start/End: Complemental strand, 27411162 - 27411120
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgca |
637 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
27411162 |
tggtggccggggttcgaaccccggaccttgcatatattatgca |
27411120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 639
Target Start/End: Complemental strand, 29600007 - 29599965
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
29600007 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
29599965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 594 - 648
Target Start/End: Original strand, 41748746 - 41748800
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| ||||| ||| ||||| ||||||||||||| |||| |
|
|
| T |
41748746 |
ttggtggtcggggtttgaatcccggatcttacatattttatgcattgtccatacc |
41748800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 41763876 - 41763922
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| || |||||||| |||||||||||| |||| |
|
|
| T |
41763876 |
cggggtttgaaccccggaccgtgcatatactatgcattgtccatacc |
41763922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 598 - 643
Target Start/End: Original strand, 3113721 - 3113766
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| |||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
3113721 |
tggtcgggatttgaatcccggaccttgcatattttatgcattgtcc |
3113766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 6765680 - 6765627
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||| ||||||||| |||| ||||| ||||||||||||| |||| |
|
|
| T |
6765680 |
tggtggtcgtggttcgaaccccggaccttacatattttatgcattgtccatacc |
6765627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 11175855 - 11175802
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| ||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
11175855 |
tggtggccggagtttgaaccccagatcttgcatatattatgcattgtccatacc |
11175802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 11931675 - 11931622
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| |||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
11931675 |
tggtggccgggttttgtatcccggatcttgcatatattatgcattgtccctacc |
11931622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 602 - 643
Target Start/End: Complemental strand, 12413556 - 12413515
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
12413556 |
cggggtttgaacctcagaccttgcatatattatgcattgtcc |
12413515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 602 - 643
Target Start/End: Complemental strand, 12425616 - 12425575
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
12425616 |
cggggtttgaacctcagaccttgcatatattatgcattgtcc |
12425575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 17142900 - 17142847
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| || | | ||||||||||||| ||||||| ||||| |
|
|
| T |
17142900 |
tggtggtcggggtttgaactccagactttgcatatattatacattgtcactacc |
17142847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 21482510 - 21482563
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||| |||| ||| |||| |
|
|
| T |
21482510 |
tggtggtcggggttcaaaccccggaccttgcatatattatacattatccttacc |
21482563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 604 - 641
Target Start/End: Complemental strand, 22520278 - 22520241
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
22520278 |
gggtttgaacctcaggccttgcatatattatgcattgt |
22520241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 643
Target Start/End: Original strand, 24579670 - 24579707
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||| |
|
|
| T |
24579670 |
gtttgaaccctggaccttgcatatattatgcattgtcc |
24579707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 25395433 - 25395486
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| |||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
25395433 |
tggtggtcgggatttgaaccttgaaccttgcatatattatgcattgttcctacc |
25395486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 26999180 - 26999127
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| ||||||||| | | ||||||||||||||||||||||| ||||| |
|
|
| T |
26999180 |
tggtggccggagtttgaaccgcagaccttgcatatattatgcattgtctctacc |
26999127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 27412827 - 27412880
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| | | |||| |||||||||||||||||| ||||| |
|
|
| T |
27412827 |
tggtggtcggggtttgaacaacagaccttacatatattatgcattgtctctacc |
27412880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29809396 - 29809343
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
29809396 |
tggtggccgggattcgaaccccgtacctttcatatattatgcattgtccctacc |
29809343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 30243320 - 30243267
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || ||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
30243320 |
tggtggccgaggtttgaaccccgaaccttgtatatattatgcattgtctctacc |
30243267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 31477041 - 31476988
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| ||||||||||| ||||| |||||||||||||| |||||||| |
|
|
| T |
31477041 |
tggtggccgggatttgaaccccgaaccttgtatatattatgcattctccctacc |
31476988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 600 - 641
Target Start/End: Complemental strand, 32458367 - 32458326
Alignment:
| Q |
600 |
gtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
32458367 |
gtcggagtttgaaccctggaccttgcatatattatgcattgt |
32458326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 597 - 642
Target Start/End: Complemental strand, 41356220 - 41356175
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
41356220 |
gtggtcggggtttgaaccccgaaccttgtatattttatgcattgtc |
41356175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 43117189 - 43117234
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||||||||| |||| |
|
|
| T |
43117189 |
ggggtttgaacctcagaccttgcatatattatgcattgtccttacc |
43117234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 640
Target Start/End: Complemental strand, 44810767 - 44810730
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattg |
640 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
44810767 |
ggggtttgaaccccggaccttgcatatattatgtattg |
44810730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Complemental strand, 961148 - 961120
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
961148 |
ccttgcatatattatgcattgtccctacc |
961120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 4238829 - 4238781
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| ||| |||||||| |||| ||||||||||||||||||| |
|
|
| T |
4238829 |
tggtggtcggagttcgaaccccgaaccttacatatattatgcattgtcc |
4238781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 602 - 642
Target Start/End: Complemental strand, 5676802 - 5676762
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5676802 |
cggggtttgaacccccacccttgcatatattatgcattgtc |
5676762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 10724009 - 10723965
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| ||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
10724009 |
tggtggccggggtttgaacctcagaccttgcatatattatgcatt |
10723965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 644
Target Start/End: Original strand, 17328006 - 17328046
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
||||||||||||||| |||||| ||| |||||||||||||| |
|
|
| T |
17328006 |
gggtttgaaccccggaccttgcttattttatgcattgtccc |
17328046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 25598562 - 25598606
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25598562 |
gggttcgaaccctggaccttgcatatattatgcattgtccatacc |
25598606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 27152414 - 27152370
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||||||| | |||||||||||||||||||| |||||||| |
|
|
| T |
27152414 |
gggttcgaaccccagaccttgcatatattatgcattatccctacc |
27152370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 33064056 - 33064008
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||| ||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
33064056 |
tggtggccggagttcgaactccggaccttgcatatattatgcattgtcc |
33064008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 606 - 646
Target Start/End: Original strand, 35287666 - 35287706
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
35287666 |
gtttaaaccccggaccttgcatctattatgcattgtcccta |
35287706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 40994768 - 40994816
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| |||||||||||| |||||||| ||||||| ||||||| |
|
|
| T |
40994768 |
tggtggtcggtgtttgaaccccgaaccttgcatctattatgtattgtcc |
40994816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 41778935 - 41778983
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||| || ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41778935 |
tggtggccgggattcgaacctcggaccttgcatatattatgcattgtcc |
41778983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 46; Significance: 7e-17; HSPs: 80)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 34436921 - 34436868
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34436921 |
tggtgggcggggtttgaaccccggcccttgcatatattatgcattgtccctacc |
34436868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 593 - 645
Target Start/End: Original strand, 32200436 - 32200488
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
32200436 |
gttggtggtcggggcttgaaccccggaccttgcatatattatgcattgtccct |
32200488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 6489077 - 6489024
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
6489077 |
tggtggccggggtttgaaccccagaccttgcatatattatgcattgtccctacc |
6489024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 15889481 - 15889428
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
15889481 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctacc |
15889428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 16701572 - 16701625
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
16701572 |
tggtggtcggggtttgaatcccggaccttgcatatattattcattgtccctacc |
16701625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 22522792 - 22522845
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
22522792 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
22522845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 40715940 - 40715988
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40715940 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtcc |
40715988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 13864414 - 13864368
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
13864414 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgt |
13864368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 19518591 - 19518637
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19518591 |
tggtggtcgaggtttgaacccccggccttgcatatattatgcattgt |
19518637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 6424902 - 6424947
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
6424902 |
ggggtttgaaccccggaccttgtatatattatgcattgtccctacc |
6424947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 11720963 - 11720911
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11720963 |
tggtggccggggtttgaaccccga-ccttgcatatattatgcattgtccctacc |
11720911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 20721120 - 20721067
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
20721120 |
tggtagtcggggtttgaaccccggaccttgcatatattatgtattgtccatacc |
20721067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 6624846 - 6624798
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
6624846 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgtcc |
6624798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 42817103 - 42817151
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| |||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
42817103 |
tggtggtcgaggtttgaaccccggaccttgtatatattatgcattgtcc |
42817151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 597 - 644
Target Start/End: Complemental strand, 34191501 - 34191454
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
34191501 |
gtggccggggtttgaaccccggaccttgcatattttatgcattgtccc |
34191454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 4009937 - 4009883
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatatt-atgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||| ||||||||||| |||| |
|
|
| T |
4009937 |
tggtggccggggtttgaaccccggcccttgcatatattaatgcattgtccttacc |
4009883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 16579365 - 16579411
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||| ||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
16579365 |
tggtggtcagggtttgaaccacggaccttgcatatattatgcattgt |
16579411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 597 - 643
Target Start/End: Complemental strand, 24408563 - 24408517
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||| |||| |
|
|
| T |
24408563 |
gtggtcggggtttgaaccccagaccttgcatatattatgcatcgtcc |
24408517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 26409324 - 26409270
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||| ||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
26409324 |
ttggtgggcggggttcgaaccccggaccttacatatattatgcattgtccatacc |
26409270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 27903183 - 27903137
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
27903183 |
tggtggtcggagtttgaaccccgaaccttgcatatattatgcattgt |
27903137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 39914971 - 39914918
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
39914971 |
ttggtggtcggggttcgaaccc-ggaccttgcatatattatgcattgtccttacc |
39914918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 3052349 - 3052296
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||| || ||||||||||||||| ||||||||||||| |
|
|
| T |
3052349 |
tggtggtcgaggtttgaacctcgaaccttgcatatattatacattgtccctacc |
3052296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 3445238 - 3445291
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| |||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
3445238 |
tggtggccgggatttgaaccccggaccttgcatacattatgcattgtccttacc |
3445291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 11637563 - 11637616
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
11637563 |
tggtggtcggggttcgaaccccgaaccttgcatattttatgcattgtccatacc |
11637616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 18331777 - 18331724
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||| ||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
18331777 |
tggtggccggggcttgaaccccggaccttgcatattttatgcattgtccatacc |
18331724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 18749166 - 18749219
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| |||| ||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
18749166 |
tggtggccggagtttaaaccccgggccgtgcatatattatgcattgtccatacc |
18749219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 19647499 - 19647552
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| |||||||||| | |||| |||||||||| ||||||||||||| |
|
|
| T |
19647499 |
tggtggtcgggatttgaaccccagaccttacatatattatacattgtccctacc |
19647552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 26655534 - 26655481
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| ||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
26655534 |
tggtggccggggttcgaaccccggaccttacatatattatgcattgtccatacc |
26655481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 26927119 - 26927066
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| ||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
26927119 |
tggtggccggggttcgaaccccggaccttacatatattatgcattgtccatacc |
26927066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 37054260 - 37054313
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37054260 |
tggtggtcggagtttgaaccccgaaccttatatatattatgcattgtccctacc |
37054313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 37932400 - 37932347
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| | ||||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
37932400 |
tggtggccagggttcgaaccccggaccttgcatatattatgcattgtccatacc |
37932347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 39980578 - 39980525
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||| ||| |||| |
|
|
| T |
39980578 |
tggtggtcggggtttgaactccggaccttgcatattttatgcattatccatacc |
39980525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 5107236 - 5107280
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
5107236 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcatt |
5107280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 8544980 - 8545028
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| ||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
8544980 |
tggtggtcggagttcgaactccggaccttgcatatattatgcattgtcc |
8545028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 10531610 - 10531562
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||| ||||||||||||||| ||| || ||||||||||||||||||||| |
|
|
| T |
10531610 |
tggtagtcggggtttgaaccacggaccgtgcatatattatgcattgtcc |
10531562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 594 - 642
Target Start/End: Complemental strand, 25979915 - 25979867
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||| || |||||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
25979915 |
ttggtggccgaggtttgaaccccggaccttgcatacattatgcattgtc |
25979867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 29695085 - 29695037
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
29695085 |
tggtggtcggggtttgaaccacgaaccttacatatattatgcattgtcc |
29695037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 31280089 - 31280041
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
31280089 |
tggtggtcgaggtttgaaccccggatattgcatatattatgcattgtcc |
31280041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 32234831 - 32234784
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
32234831 |
tggtggtcggggtttgaacccc-gaccttgcatattttatgcattgtcc |
32234784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 37462181 - 37462133
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
37462181 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
37462133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 602 - 646
Target Start/End: Original strand, 41630110 - 41630154
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
41630110 |
cggggtttgaatcccgaaccttgcatatattatgcattgtcccta |
41630154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 605 - 641
Target Start/End: Complemental strand, 42473954 - 42473918
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42473954 |
ggtttgaaccccggaccttgcatatattatgcattgt |
42473918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Complemental strand, 5485246 - 5485203
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
5485246 |
ggttagaaccccggacattgcatatattatgcattgtccctacc |
5485203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 598 - 641
Target Start/End: Complemental strand, 13409617 - 13409574
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
13409617 |
tggtcggggtttgaactccggaccttgtatatattatgcattgt |
13409574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 21139146 - 21139193
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgca-ttgtccctacc |
648 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
21139146 |
cgggttttgaaccccggaccttgcatatattatgcatttgtccctacc |
21139193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 35493964 - 35494011
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
35493964 |
tggtggtcggagtttgaatcccgaaccttgcatatattatgcattgtc |
35494011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 40837896 - 40837947
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||| ||||||| |||| |
|
|
| T |
40837896 |
gtggtcggggtttgaaccccggaccttgcatattttatatattgtccatacc |
40837947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 1538799 - 1538845
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
1538799 |
tggtggtcggcgtttgaacctcggaccttgcatatattatgcgttgt |
1538845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 593 - 643
Target Start/End: Complemental strand, 5015352 - 5015302
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| ||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
5015352 |
gttggtggttggggtttgaactccgaaccttgcatatattattcattgtcc |
5015302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 5846092 - 5846046
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| | | |||||||||||||||||||||| |||| |
|
|
| T |
5846092 |
cggggtttgaaccccagactttgcatatattatgcattgtccttacc |
5846046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 648
Target Start/End: Original strand, 10704333 - 10704375
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
10704333 |
gtttgaaccccggaccttgcatattttatgcattgtccatacc |
10704375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 13796400 - 13796354
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||| ||||| ||||| | |||||||||||||||||||||| |
|
|
| T |
13796400 |
tggtggtcggagtttgtaccccagaccttgcatatattatgcattgt |
13796354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 14474904 - 14474858
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||||||||||| |||| |
|
|
| T |
14474904 |
tggtggccggggtttgaaccctggaccttgcatatattatgcgttgt |
14474858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 596 - 646
Target Start/End: Complemental strand, 16094126 - 16094076
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||||| |||||| |
|
|
| T |
16094126 |
ggtggtcggggtttgaaccccagatcttacatatattatgcattatcccta |
16094076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 32339805 - 32339759
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| |||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
32339805 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattgt |
32339759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 644
Target Start/End: Complemental strand, 33928698 - 33928660
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
|||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
33928698 |
gtttaaaccccggaccttgcatatattatgcattgtccc |
33928660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 605 - 642
Target Start/End: Original strand, 4763187 - 4763224
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
4763187 |
ggtttgaaccccggaccttacatatattatgcattgtc |
4763224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 598 - 643
Target Start/End: Complemental strand, 10515620 - 10515575
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
10515620 |
tggtcggaatttgaaccccaggccttgcatatattattcattgtcc |
10515575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 12611026 - 12611079
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||| ||||||| | |||||||||| ||||||||||||| |||| |
|
|
| T |
12611026 |
tggtggtcgaggttcgaaccccagaccttgcatattttatgcattgtccatacc |
12611079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 598 - 643
Target Start/End: Complemental strand, 16076498 - 16076453
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| |||||||| | |||||||||||||||||||||||| |
|
|
| T |
16076498 |
tggtcggggattgaaccctgaaccttgcatatattatgcattgtcc |
16076453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 17090936 - 17090883
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||| |||||||||| ||| |||| |
|
|
| T |
17090936 |
tggtggccggggtttgaaccccggaccttgcattaattatgcattatccatacc |
17090883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 599 - 648
Target Start/End: Original strand, 17210704 - 17210753
Alignment:
| Q |
599 |
ggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
17210704 |
ggtcggagtttgaaccccacaccttgcatatattatgcactgtccctacc |
17210753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 18391670 - 18391617
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||| ||||| ||| |||||||||| ||||||||||||| |||| |
|
|
| T |
18391670 |
tggtggtcgaggttcgaacctcggaccttgcatattttatgcattgtccttacc |
18391617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 604 - 641
Target Start/End: Original strand, 18589867 - 18589904
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
18589867 |
gggtttaaaccccggaccttgcatatattatgcattgt |
18589904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 18789098 - 18789053
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
18789098 |
ggggtttgaaccccgaaccttgcatattttatgcattgtctctacc |
18789053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 19759999 - 19759946
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||| | |||| ||| |||||||||||||||||||||| |||||| |
|
|
| T |
19759999 |
tggtggttggggtcttaacctcggaccttgcatatattatgcattgtacctacc |
19759946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 643
Target Start/End: Complemental strand, 20688099 - 20688062
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
20688099 |
gtttgaactccggaccttgcatatattatgcattgtcc |
20688062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 22555301 - 22555248
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||| |||||||||||| |||| |
|
|
| T |
22555301 |
tggtggtcggggtttgattcccggaccttgcatattatatgcattgtccatacc |
22555248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 607 - 648
Target Start/End: Original strand, 27545160 - 27545201
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
27545160 |
tttgaacctcgacccttgcatatattatgcattgtccctacc |
27545201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 31877990 - 31877945
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
31877990 |
ggggtttgaacccctgatcttgcatatattatgcattgtccatacc |
31877945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 41650931 - 41650983
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||| | || |||||||||||||||||||||||| |||| |
|
|
| T |
41650931 |
tggtggtcggtgtttgaactc-ggaccttgcatatattatgcattgtccatacc |
41650983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 12670065 - 12670109
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
12670065 |
tggtggtcaaggtttgaaccccgaaccttgcatatattatgcatt |
12670109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 20125095 - 20125048
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
20125095 |
tggtggtcggagtttgaaccc-gaaccttgcatatattatgcattgtcc |
20125048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 26030442 - 26030490
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||| ||||||||||||||| |
|
|
| T |
26030442 |
tggtggccggggttcgaaccccggaccttgcaagtattatgcattgtcc |
26030490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Complemental strand, 33654793 - 33654765
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33654793 |
ccttgcatatattatgcattgtccctacc |
33654765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 35413026 - 35412979
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
35413026 |
tggtggccggggttcgaaccc-ggaccttgcatatattatgcattgtcc |
35412979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 37021363 - 37021407
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||| |
|
|
| T |
37021363 |
tggtggtcggggtttgaaccctgaatcttgcatatattatgcatt |
37021407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 600 - 648
Target Start/End: Complemental strand, 38495207 - 38495159
Alignment:
| Q |
600 |
gtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||| ||| |||| |
|
|
| T |
38495207 |
gtcggggtttgaaccccgaaccttgcatattttatgcattatccatacc |
38495159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 39963563 - 39963515
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| | |||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
39963563 |
tggtggtcagagtttgaaccccgaaccttacatatattatgcattgtcc |
39963515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 597 - 648
Target Start/End: Complemental strand, 42515876 - 42515824
Alignment:
| Q |
597 |
gtggtcggggtttgaa-ccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||||| |||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
42515876 |
gtggccggggtttgaatccccggaccttacatatattatgcattgtccatacc |
42515824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 7e-17; HSPs: 118)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 11949754 - 11949807
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
11949754 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
11949807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000004
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 19479468 - 19479514
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19479468 |
tggtggtcggggtttgaaccccggaccttgcatatattatgcattgt |
19479514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 9946497 - 9946444
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
9946497 |
tggtggtcggggtttgaaccccggaccttgcatattttatgcattgtccatacc |
9946444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 21114296 - 21114349
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
21114296 |
tggtggtcggggtttgaaccccggaccttgcatatatcatgcattgtccatacc |
21114349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 21318244 - 21318297
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
21318244 |
tggtggtcggggtttgaaccctagaccttgcatatattatgcattgtccctacc |
21318297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 20799394 - 20799438
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
20799394 |
gggtttgaaccccggaccttgcatatattatgcattgtccctacc |
20799438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 593 - 648
Target Start/End: Original strand, 22164258 - 22164313
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| | |||| ||||||||||||||||| |||||| |
|
|
| T |
22164258 |
gttggtggtcggggtttgaaccccagaccttacatatattatgcattgttcctacc |
22164313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 49041972 - 49042019
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49041972 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtc |
49042019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 606 - 648
Target Start/End: Original strand, 25783451 - 25783493
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
25783451 |
gtttgaaccccggaccttgcatatattatgcattgtccctacc |
25783493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 836226 - 836279
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| ||||||||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
836226 |
tggtggtcggagtttgaacctcggaccttgcatatattttgcattgtccctacc |
836279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 7230350 - 7230297
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
7230350 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccttacc |
7230297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 19908762 - 19908709
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
19908762 |
tggtggtcggggttcgaacctcggaccttgcatatattatgcattgtccttacc |
19908709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 20383550 - 20383505
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
20383550 |
ggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
20383505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 22630351 - 22630404
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||||||| ||||| |
|
|
| T |
22630351 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtcactacc |
22630404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 23775588 - 23775535
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
23775588 |
tggtggttggggttcgaaccctggaccttgcatatattatgcattgtccctacc |
23775535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 24664982 - 24665035
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||| ||| |||| |
|
|
| T |
24664982 |
tggtggtcggggttcgaaccccggaccttgcatatattatgcattctccatacc |
24665035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 37930838 - 37930891
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||||||||| |||||| |
|
|
| T |
37930838 |
tggtggtcggggtttgaacctcagaccttgcatatattatgcattgtacctacc |
37930891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 38375027 - 38374974
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||| || | ||||||||||||||||||||||||||||| |
|
|
| T |
38375027 |
tggtggccggggtttgaactccagaccttgcatatattatgcattgtccctacc |
38374974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 56551583 - 56551636
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
56551583 |
tggtggccggggtttgaacctcggaccttgcatatattatgcattgtccttacc |
56551636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 603 - 643
Target Start/End: Complemental strand, 675980 - 675940
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
675980 |
ggggtttgaaccccggaccttgcatatattatgcattgtcc |
675940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 11198398 - 11198350
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
11198398 |
tggtggccggggtttgaaccccggaccttgcatatattatgccttgtcc |
11198350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 24079831 - 24079879
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
24079831 |
tggtggtcggggtttgaactccggaccttgcatattttatgcattgtcc |
24079879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 42845095 - 42845047
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
42845095 |
tggtggtcggagttttaaccccggaccttgcatatattatgcattgtcc |
42845047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 605 - 648
Target Start/End: Original strand, 50362140 - 50362183
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
50362140 |
ggtttgaaccctggaccttgcatatattatgcattgtccctacc |
50362183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 3936697 - 3936651
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
3936697 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgt |
3936651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 597 - 639
Target Start/End: Original strand, 14202472 - 14202514
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
14202472 |
gtggtcggggtttgaaccccggaccttacatatattatgcatt |
14202514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 606 - 648
Target Start/End: Original strand, 17423179 - 17423221
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
17423179 |
gtttgaaccccggaccttgcatatattatgcattgtctctacc |
17423221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 637
Target Start/End: Complemental strand, 17729496 - 17729454
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgca |
637 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
17729496 |
tggtggtcggggtttgaaccccagaccttgcatatattatgca |
17729454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 54857606 - 54857652
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
54857606 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgt |
54857652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 8027388 - 8027441
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||| ||| |||| |
|
|
| T |
8027388 |
tggtggtcggggtttgaacccccgatcttgcatatattatgcattatccttacc |
8027441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 14197422 - 14197475
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| | |||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
14197422 |
tggtggttgaggtttgaaccccggatcttacatatattatgcattgtccctacc |
14197475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 16304089 - 16304142
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
16304089 |
tggtggccgcggtttgaatcccggaccttgcatatattatgcattgtccatacc |
16304142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 16470374 - 16470321
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
16470374 |
tggtggtcggggttcgaaccctggaccttgcatattttatgcattgtccatacc |
16470321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 19588224 - 19588171
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
19588224 |
tggtggccggggtttgaaccctggaccttgcatattttatgcattgtccatacc |
19588171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 19997355 - 19997408
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
19997355 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgtctctacc |
19997408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 21317329 - 21317382
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| | |||||||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
21317329 |
tggtggttgaggtttgaacccctgaccttgcatatattatgcattgtctctacc |
21317382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 23304007 - 23304060
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| | ||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
23304007 |
tggtggccggggttcgcaccccggaccttgcatatattatgccttgtccctacc |
23304060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 28435247 - 28435292
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
28435247 |
ggggtttgaaccccgaaccttgcatatattatgcattgtccatacc |
28435292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29908126 - 29908073
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||| ||||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
29908126 |
tggtgatcgaggtttgaactccggaccttgcatatattatgcattgtccttacc |
29908073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 640
Target Start/End: Complemental strand, 34042310 - 34042265
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattg |
640 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34042310 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattg |
34042265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 36490638 - 36490585
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| |||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
36490638 |
tggtggtcgggatttgaaccccggatcttgcatacattatgcattgtccatacc |
36490585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 602 - 643
Target Start/End: Complemental strand, 37921809 - 37921768
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37921809 |
cggggtttgaatcccggaccttgcatatattatgcattgtcc |
37921768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 43034333 - 43034386
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||| | | |||||||||||||||||||||||| |||| |
|
|
| T |
43034333 |
tggtggccggggtttgaacctcagaccttgcatatattatgcattgtccatacc |
43034386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 602 - 639
Target Start/End: Complemental strand, 44816004 - 44815967
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44816004 |
cggggtttgaaccccggaccttgcatatattatgcatt |
44815967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 49473707 - 49473662
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
49473707 |
ggggttcgaaccccggaccttgcatatattatgcattgtccttacc |
49473662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 606 - 643
Target Start/End: Original strand, 49953405 - 49953442
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49953405 |
gtttgaaccccggaccttgcatatattatgcattgtcc |
49953442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 602 - 639
Target Start/End: Original strand, 54294420 - 54294457
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54294420 |
cggggtttgaaccccggaccttgcatatattatgcatt |
54294457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 54500639 - 54500586
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| | ||||||||||||| |||| |||||||||||||||||| ||||| |
|
|
| T |
54500639 |
tggtggtcagtgtttgaaccccggaccttacatatattatgcattgtctctacc |
54500586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 55061107 - 55061054
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
55061107 |
tggtggtcggaatttgaacccccgaccttgcatatattatgcattgtccgtacc |
55061054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 2649733 - 2649777
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
2649733 |
gggttcgaactccggaccttgcatatattatgcattgtccctacc |
2649777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 5924719 - 5924671
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| |||||||||||||| |||| ||||||||||| ||||||| |
|
|
| T |
5924719 |
tggtggtcgaggtttgaaccccggaccttccatatattatgtattgtcc |
5924671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 10261760 - 10261808
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
10261760 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
10261808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 21562695 - 21562647
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
21562695 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
21562647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 26926701 - 26926749
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
26926701 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
26926749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 596 - 648
Target Start/End: Complemental strand, 42139913 - 42139861
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||||||||||||||||| | |||||| ||||||||||||||| |||| |
|
|
| T |
42139913 |
ggtggccggggtttgaaccccggacattgcatgtattatgcattgtccatacc |
42139861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 43330216 - 43330168
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
43330216 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
43330168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 43722826 - 43722782
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
43722826 |
gggtttgaaccccggaccttacatatattatgcattgtccatacc |
43722782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 594 - 642
Target Start/End: Original strand, 43782295 - 43782343
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||| |||||||||| | | ||||||||||||||||||||||| |
|
|
| T |
43782295 |
ttggtggtcgaggtttgaaccgcagaccttgcatatattatgcattgtc |
43782343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 47015559 - 47015607
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| ||||||||||| | ||||| |||||||||||||||||| |
|
|
| T |
47015559 |
tggtggtcggagtttgaaccccagaccttgtatatattatgcattgtcc |
47015607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 47806247 - 47806295
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||| |||||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
47806247 |
tggtgttcggggttcgaaccccagaccttgcatatattatgcattgtcc |
47806295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 51450282 - 51450234
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
51450282 |
tggtggccggggtttgaactccggaccttgcatatcttatgcattgtcc |
51450234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Complemental strand, 281651 - 281608
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
281651 |
ggtttgaaccccggacctttcatatattatgcattgtccatacc |
281608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Complemental strand, 12322733 - 12322690
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
12322733 |
ggtttgaaccccggaacttgcatatattatgcattgtccgtacc |
12322690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 604 - 643
Target Start/End: Complemental strand, 22040711 - 22040672
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22040711 |
gggtttgaaccccgaaccttgcatatattatgcattgtcc |
22040672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 598 - 641
Target Start/End: Original strand, 40070962 - 40071005
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
40070962 |
tggtcggggtttgaacttcggaccttgcatatattatgcattgt |
40071005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 47814244 - 47814295
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| |||||| |||| |
|
|
| T |
47814244 |
gtggccggggtttgaaccccggaccttgcatatattatgtgttgtccatacc |
47814295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 1753350 - 1753396
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||||||| |||| |
|
|
| T |
1753350 |
cggggtttgaacccccgaccttgcatatgttatgcattgtccttacc |
1753396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 2888944 - 2888890
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgca-ttgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||| ||| ||||||||||||||| || ||||||||||| |
|
|
| T |
2888944 |
tggtggccggggtttgaaccgcggaccttgcatatattatacatttgtccctacc |
2888890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 639
Target Start/End: Complemental strand, 6610331 - 6610289
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| |||| |
|
|
| T |
6610331 |
gtggtcggggtttgaaccccagaccttgcatatattatacatt |
6610289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 593 - 643
Target Start/End: Original strand, 7371537 - 7371587
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||| ||||||| ||||||||| |||||||||||||||| ||||||| |
|
|
| T |
7371537 |
gttggtgtccggggttcgaaccccggaccttgcatatattatgtattgtcc |
7371587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 598 - 648
Target Start/End: Original strand, 9435474 - 9435524
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||| | |||| |||||||||||||||||||||||| |
|
|
| T |
9435474 |
tggtcggggtttgattcccagacctttcatatattatgcattgtccctacc |
9435524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 13121607 - 13121561
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
13121607 |
cggggtttgaacttcagaccttgcatatattatgcattgtccctacc |
13121561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 14577505 - 14577551
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||||||||||| |||| |
|
|
| T |
14577505 |
cggggtttgaactccggactttgcatatattatgcattgtccttacc |
14577551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 16431679 - 16431633
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| | |||||||||| ||||||||||||| |||| |
|
|
| T |
16431679 |
cggggtttgaaccccagaccttgcatattttatgcattgtccatacc |
16431633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 594 - 648
Target Start/End: Original strand, 18915036 - 18915090
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| || ||||||||| || || |||||||||||||||||| |||| |
|
|
| T |
18915036 |
ttggtggtcgggattcgaaccccggaccatgaatatattatgcattgtccttacc |
18915090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 648
Target Start/End: Complemental strand, 23160099 - 23160057
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
23160099 |
gtttgaacctcggaccttacatatattatgcattgtccctacc |
23160057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 598 - 648
Target Start/End: Complemental strand, 25115116 - 25115066
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| | |||||||||| ||||||||||||| |||| |
|
|
| T |
25115116 |
tggtcggggtttgaaccctgaaccttgcatatgttatgcattgtccatacc |
25115066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 29701159 - 29701105
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||| ||||||||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
29701159 |
ttggtggccggagtttgaaccccggaacttgcatatattatacattgtccatacc |
29701105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 35287498 - 35287544
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
35287498 |
tggtggccggggttggaaccccggaccttgcatattttatgcattgt |
35287544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 41521025 - 41520971
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
41521025 |
ttggtggtcggagtttgaaccttgaaccttgcatatattatgcattgtctctacc |
41520971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 43374265 - 43374311
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
43374265 |
gtggtcggggtttgaactccgaaccttgcatattttatgcattgtcc |
43374311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 610 - 648
Target Start/End: Original strand, 46676504 - 46676542
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
46676504 |
gaaccccggaccttgcatatattatgcattgtccttacc |
46676542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 897487 - 897442
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||| |||| |||||||||| |||||||| |||| |
|
|
| T |
897487 |
ggggtttgaaccccggaccttacatatattatacattgtccatacc |
897442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 8495057 - 8495004
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| ||||||| | || |||||||||||||||||||||||||||| |
|
|
| T |
8495057 |
tggtggccgggatttgaactcgggatcttgcatatattatgcattgtccctacc |
8495004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 607 - 648
Target Start/End: Complemental strand, 13276187 - 13276146
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| | ||| ||||||||||||||||||||||||||||| |
|
|
| T |
13276187 |
tttgaaacacggaccttgcatatattatgcattgtccctacc |
13276146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 15988487 - 15988434
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||| ||||||||| ||||| ||||| |||||||||||| |||| |
|
|
| T |
15988487 |
tggtggtcgaggttcgaaccccggaccttgtatatagtatgcattgtccttacc |
15988434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 597 - 642
Target Start/End: Complemental strand, 16737139 - 16737094
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||| ||| |||||||||| | ||||||||||||||||||||||| |
|
|
| T |
16737139 |
gtggttgggatttgaacccccgaccttgcatatattatgcattgtc |
16737094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 23247589 - 23247642
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||| |||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
23247589 |
tggtggccggggtttaaaccccagaccttgcatatattatgcgttgtccatacc |
23247642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 23810019 - 23809966
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
23810019 |
tggtggccggggtttgaaccctgaaccttgcatatattatgctttgtccatacc |
23809966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 599 - 640
Target Start/End: Original strand, 30850379 - 30850420
Alignment:
| Q |
599 |
ggtcggggtttgaaccccgggccttgcatatattatgcattg |
640 |
Q |
| |
|
||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
30850379 |
ggtcggggtttgaaccctgaaccttgcatatattatgcattg |
30850420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 602 - 643
Target Start/End: Original strand, 31138991 - 31139032
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
31138991 |
cggggtttgaacctcggaccttgcatattttatgcattgtcc |
31139032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 643
Target Start/End: Complemental strand, 37193308 - 37193271
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
37193308 |
gtttgaaccccggaccttgcatatattatacattgtcc |
37193271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 604 - 645
Target Start/End: Complemental strand, 37255009 - 37254968
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
||||| ||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
37255009 |
gggttcgaaccccggaccttacatatattatgcattgtccct |
37254968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 593 - 642
Target Start/End: Complemental strand, 37800903 - 37800854
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||| |||||||| ||||||| | ||| ||||||||||||||||||| |
|
|
| T |
37800903 |
gttggtgatcggggttcgaaccccagacctcgcatatattatgcattgtc |
37800854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 37872500 - 37872545
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| ||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
37872500 |
ggggtttgtaccccggaccttatatatattatgcattgtccctacc |
37872545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 42344609 - 42344662
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| ||||||||| ||| ||||||||||||||| |||||| |||||| |
|
|
| T |
42344609 |
tggtggtcgatgtttgaacctcggaccttgcatatattatacattgttcctacc |
42344662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 43499661 - 43499608
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| ||||| |||| |||| |||||||| |||| |
|
|
| T |
43499661 |
tggtggccggggtttgaaccccggaccttgtatattttatacattgtccatacc |
43499608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 48067203 - 48067150
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||||| |||||||| | |||||||||||||||| ||||||||||||| |
|
|
| T |
48067203 |
tggtgatcgggatttgaacctcatgccttgcatatattatacattgtccctacc |
48067150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 48171951 - 48171898
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| ||||||| ||||| |
|
|
| T |
48171951 |
tggtggtcggggtttgaacctagaaccttgcatatattatacattgtctctacc |
48171898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 606 - 643
Target Start/End: Original strand, 49952571 - 49952608
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
49952571 |
gtttgaaccccggaccttacatatattatgcattgtcc |
49952608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 53617904 - 53617851
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| | | |||| ||||||||||||||||||||||| |
|
|
| T |
53617904 |
tggtggtcggggtttgaacagcagaccttaaatatattatgcattgtccctacc |
53617851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 56497599 - 56497652
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
56497599 |
tggtggccgggattcgaaccccagaccttgcatatattatgcattgtccttacc |
56497652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Original strand, 3346290 - 3346318
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3346290 |
ccttgcatatattatgcattgtccctacc |
3346318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 603 - 639
Target Start/End: Complemental strand, 6087809 - 6087773
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||||| |
|
|
| T |
6087809 |
ggggtttgaaccccagaccttgcatatattatgcatt |
6087773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 8607197 - 8607149
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||| |||||||||||||| |||| |||| |||| |||||||||||||| |
|
|
| T |
8607197 |
tggtagtcggggtttgaactccggaccttacatacattatgcattgtcc |
8607149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 635
Target Start/End: Complemental strand, 10035335 - 10035295
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatg |
635 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||||||| |
|
|
| T |
10035335 |
tggtggccggggtttgaaccccagaccttgcatatattatg |
10035295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 14542751 - 14542799
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||| || ||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
14542751 |
tggtgttcagggttcgaaccccagaccttgcatatattatgcattgtcc |
14542799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Complemental strand, 16995830 - 16995802
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
16995830 |
ccttgcatatattatgcattgtccctacc |
16995802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 18903749 - 18903793
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||| ||||||||||||| | |||| ||||||||||||||| |
|
|
| T |
18903749 |
tggtggtcagggtttgaaccccagaccttacatatattatgcatt |
18903793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Original strand, 21623435 - 21623463
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21623435 |
ccttgcatatattatgcattgtccctacc |
21623463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 21649348 - 21649300
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| |||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
21649348 |
tggtggtcgggatttgaagcccgatccttacatatattatgcattgtcc |
21649300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 31041707 - 31041755
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| ||| ||||||||| | ||||||||||||| |||||||| |
|
|
| T |
31041707 |
tggtggtcggagttcgaaccccggacattgcatatattatacattgtcc |
31041755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 610 - 642
Target Start/End: Original strand, 34834012 - 34834044
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
34834012 |
gaaccccggaccttgcatatattatgcattgtc |
34834044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 599 - 639
Target Start/End: Complemental strand, 36035900 - 36035860
Alignment:
| Q |
599 |
ggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
36035900 |
ggtcggagtttgaaccccggaccttggatatattatgcatt |
36035860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 603 - 643
Target Start/End: Complemental strand, 38453327 - 38453287
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
38453327 |
ggggttcgaaccctggaccttgcatatattatgcattgtcc |
38453287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 597 - 641
Target Start/End: Complemental strand, 48226760 - 48226716
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||| ||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
48226760 |
gtggccggagtttgaaccccggaccttgcatattttatgcattgt |
48226716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 602 - 638
Target Start/End: Original strand, 50152236 - 50152272
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcat |
638 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
50152236 |
cggggtttgaaccccgaaccttgcatatattatgcat |
50152272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 599 - 639
Target Start/End: Original strand, 52869004 - 52869044
Alignment:
| Q |
599 |
ggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||| |||| ||||| |||||||||||||| |
|
|
| T |
52869004 |
ggtcggggtttgaactccggaccttgtatatattatgcatt |
52869044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 7e-17; HSPs: 109)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 17139508 - 17139561
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
17139508 |
tggtggtcggggtttgaaccccggaccttgaatatattatgcattgtccctacc |
17139561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 7e-17
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 27533313 - 27533260
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
27533313 |
tggtggtcggggtttgaaccccgaaccttgcatatattatgcattgtccctacc |
27533260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 12268977 - 12269028
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
12268977 |
gtggtcggggtttgaaccccggaccttgcatatattatgcattgttcctacc |
12269028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 8269359 - 8269412
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
8269359 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccttacc |
8269412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 41973325 - 41973272
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41973325 |
tggtggccggggttcgaaccccggaccttgcatatattatgcattgtccctacc |
41973272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 596 - 648
Target Start/End: Complemental strand, 12212364 - 12212312
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||| |||||||| |
|
|
| T |
12212364 |
ggtggtcggggtttgaaccccggacgttgcatatattatgcattatccctacc |
12212312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 597 - 643
Target Start/End: Complemental strand, 2994826 - 2994780
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
2994826 |
gtggtcggggtttgaaccccggaccttgcatatattatacattgtcc |
2994780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 25533036 - 25532990
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
25533036 |
cggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
25532990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 8736505 - 8736452
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
8736505 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgtccatacc |
8736452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 597 - 642
Target Start/End: Complemental strand, 18166670 - 18166625
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
18166670 |
gtggtcggggtttgaaccccggactttgcatatattatgcattgtc |
18166625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 33153871 - 33153924
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||||||||||| ||| |||| |||||||||||||||||||||||| |
|
|
| T |
33153871 |
tggtgttcggggtttgaacctcggaccttacatatattatgcattgtccctacc |
33153924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 34521181 - 34521234
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
34521181 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcattgtccatacc |
34521234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 1794666 - 1794618
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1794666 |
tggtggtcgaggtttgaaccccggatcttgcatatattatgcattgtcc |
1794618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 16307719 - 16307671
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||||||||||||||| |
|
|
| T |
16307719 |
tggtggtcggggtttgatccccagaccttgcatatattatgcattgtcc |
16307671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 607 - 643
Target Start/End: Complemental strand, 44641585 - 44641549
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44641585 |
tttgaaccccgggccttgcatatattatgcattgtcc |
44641549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 595 - 646
Target Start/End: Complemental strand, 10293006 - 10292955
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
10293006 |
tggtggtcggggtttaaaccccgtcccttacatatattatgcattgtcccta |
10292955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 595 - 646
Target Start/End: Original strand, 16033441 - 16033492
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||| ||| ||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
16033441 |
tggtggccggagtttgaaccccagaccttgcatatattatgcattgtcccta |
16033492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 597 - 648
Target Start/End: Complemental strand, 32561041 - 32560990
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
32561041 |
gtggtcgggatttgaaccccggaccttgcatatattatacattgtccatacc |
32560990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 41763148 - 41763199
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
| T |
41763148 |
gtggccggggtttgaaccccggaccttgcatattttatgcattatccctacc |
41763199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 3481631 - 3481577
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgca-ttgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||||||||| ||||||||||| |
|
|
| T |
3481631 |
tggtggccggggtttgaaccccagaccttgcatatattatgcatttgtccctacc |
3481577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 596 - 642
Target Start/End: Complemental strand, 13401666 - 13401620
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
13401666 |
ggtggtcggggtttgaaccccgaaccttacatatattatgcattgtc |
13401620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 593 - 643
Target Start/End: Complemental strand, 22335430 - 22335380
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||| |||||||||||||| | | |||||||||||||||||||||||| |
|
|
| T |
22335430 |
gttggtgttcggggtttgaacctcagaccttgcatatattatgcattgtcc |
22335380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 32950752 - 32950798
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
32950752 |
tggtggtcgaggtttgaactccggaccttgcatatattatgcattgt |
32950798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 32962633 - 32962587
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||||||| || |||||||||| ||||||||||| |
|
|
| T |
32962633 |
tggtggtcggggtttgaaccctggaccttgcatattttatgcattgt |
32962587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 602 - 643
Target Start/End: Complemental strand, 5907862 - 5907821
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
5907862 |
cggggtttgaaccctggaccttgcatatattatgcattgtcc |
5907821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 602 - 643
Target Start/End: Original strand, 6000141 - 6000182
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
6000141 |
cggggtttgaacctcggaccttgcatatattatgcattgtcc |
6000182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 26803450 - 26803495
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| |||| |
|
|
| T |
26803450 |
ggggtttgaaccccggactttgcatatattatgcattgtccatacc |
26803495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29042607 - 29042554
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||||||||||||| |||||||| |
|
|
| T |
29042607 |
tggtggtcgggatttgaaccccggatcttacatatattatgcattatccctacc |
29042554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 32944806 - 32944753
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||||||| | | |||||||||||||||||||||| |||| |
|
|
| T |
32944806 |
tggtggtcggggttcgaaccccagacgttgcatatattatgcattgtccatacc |
32944753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 33020042 - 33020087
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
33020042 |
ggggtttgaacctcagaccttgcatatattatgcattgtccctacc |
33020087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 40613093 - 40613040
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| | || ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
40613093 |
tggtggtcgagattcgaaccccggaccttgcatatattatgcattgtccttacc |
40613040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 42045363 - 42045416
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||| || | |||||||||||||||||||||||| |||| |
|
|
| T |
42045363 |
tggtggccggggtttgaactccagaccttgcatatattatgcattgtccatacc |
42045416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 49431984 - 49432037
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||||||||||||| | |||||| |
|
|
| T |
49431984 |
tggtggccggggtttgaaccccggaccttacatatattatgcattattcctacc |
49432037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 609 - 645
Target Start/End: Original strand, 4968620 - 4968656
Alignment:
| Q |
609 |
tgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4968620 |
tgaaccccggaccttgcatatattatgcattgtccct |
4968656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 597 - 641
Target Start/End: Complemental strand, 23203390 - 23203346
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
23203390 |
gtggtcggggtttgaaccccgaaccttgcatattttatgcattgt |
23203346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 23405349 - 23405397
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| || |||||| || |||||||||||||||||||||||| |
|
|
| T |
23405349 |
tggtggtcgggattcgaaccctggaccttgcatatattatgcattgtcc |
23405397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 34595942 - 34595898
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| || |||||||||||||| |||||||||||||||||||| |
|
|
| T |
34595942 |
tggtggccgaggtttgaaccccggaccttgcatatattatgcatt |
34595898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 635
Target Start/End: Original strand, 51067885 - 51067925
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatg |
635 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
51067885 |
tggtggtcgggatttgaaccccgagccttgcatatattatg |
51067925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 594 - 641
Target Start/End: Original strand, 2596930 - 2596977
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
2596930 |
ttggaggtcggagtttgaaccccggaccttgcatattttatgcattgt |
2596977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Complemental strand, 5280701 - 5280654
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||||||||| |||| |
|
|
| T |
5280701 |
tggtggtcggggttcgaaccccagaccttgcatatattatgcactgtc |
5280654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 602 - 641
Target Start/End: Complemental strand, 11681286 - 11681247
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
11681286 |
cggggtttgaaccccagaccttgcatatattatgcattgt |
11681247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 648
Target Start/End: Complemental strand, 13054941 - 13054890
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||| ||||| | | ||||||||||||||||||||||||||||| |
|
|
| T |
13054941 |
gtggtcgaggttcgaacctccgaccttgcatatattatgcattgtccctacc |
13054890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 646
Target Start/End: Complemental strand, 17669715 - 17669664
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
17669715 |
tggtggccggagtttgaaccccgaaccttgcatatattatacattgtcccta |
17669664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Complemental strand, 29739397 - 29739354
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
29739397 |
ggtttgaaccccggaccttgcatattttatgcattgtccttacc |
29739354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 39252137 - 39252184
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||| || ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
39252137 |
tggtggttggagtttgaaccccggaccttgcatatattatgtattgtc |
39252184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 605 - 643
Target Start/End: Complemental strand, 1605456 - 1605418
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
1605456 |
ggtttgaaccccggaccttgcatattttatgcattgtcc |
1605418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 647
Target Start/End: Complemental strand, 1755137 - 1755087
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
|||||| |||||||||||| | ||||||||||||||||| |||||||||| |
|
|
| T |
1755137 |
gtggtcagggtttgaacccgagaccttgcatatattatgcgttgtccctac |
1755087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 604 - 642
Target Start/End: Original strand, 10654447 - 10654485
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
10654447 |
gggtttgaaccacggaccttgcatatattatgcattgtc |
10654485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 603 - 641
Target Start/End: Complemental strand, 15668560 - 15668522
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
15668560 |
ggggtttgaaccccggaccttgcatattttatgcattgt |
15668522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 633
Target Start/End: Original strand, 19795107 - 19795145
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatatta |
633 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
19795107 |
tggtggccggggtttgaaccccggaccttgcatatatta |
19795145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 21638176 - 21638130
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
21638176 |
cggggttcgaaccccggaccttgcatatatcatgcattgtccgtacc |
21638130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 24571616 - 24571662
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||| ||||||||||| | |||||||||||||||| ||||| |
|
|
| T |
24571616 |
tggtggtcggagtttgaaccccagaccttgcatatattatgtattgt |
24571662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 605 - 643
Target Start/End: Complemental strand, 26755676 - 26755638
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26755676 |
ggtttgaaccccggaccttgcatatataatgcattgtcc |
26755638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 28832162 - 28832208
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||| |||||||| | | |||||||||||||||||||||| |
|
|
| T |
28832162 |
tggtggtcgggatttgaacctcagaccttgcatatattatgcattgt |
28832208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 604 - 642
Target Start/End: Complemental strand, 34877732 - 34877694
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
34877732 |
gggtttgaacctcgggccttgcatattttatgcattgtc |
34877694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 644
Target Start/End: Complemental strand, 36679649 - 36679611
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
36679649 |
gtttgaaccccggaccttgcatatattatccattgtccc |
36679611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 610 - 648
Target Start/End: Original strand, 38448872 - 38448910
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
38448872 |
gaaccccggaccttgcatatattatgcattgtccttacc |
38448910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 639
Target Start/End: Original strand, 41769808 - 41769850
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
41769808 |
gtggtcggagtttgaaccccggaccttggatatattatgcatt |
41769850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 644
Target Start/End: Complemental strand, 45003459 - 45003421
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
45003459 |
gtttgaaccccggaccttgcatatattatccattgtccc |
45003421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 610 - 648
Target Start/End: Complemental strand, 45481548 - 45481510
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
45481548 |
gaaccccggaccttgcatatattatgcattgtccttacc |
45481510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 648
Target Start/End: Complemental strand, 46707931 - 46707889
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
46707931 |
gtttgaaccccggaacttgcatatattatgcattgtccttacc |
46707889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 127144 - 127091
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| ||| |||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
127144 |
tggtggccgggatttaaaccccggaccttgcatatataatgcattgtccttacc |
127091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 647
Target Start/End: Complemental strand, 2209284 - 2209231
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatat-tatgcattgtccctac |
647 |
Q |
| |
|
|||||||||||||||||| ||||| ||| |||||||| |||||||||| ||||| |
|
|
| T |
2209284 |
tggtggtcggggtttgaagcccggacctagcatatatatatgcattgttcctac |
2209231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 3431400 - 3431347
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| || | |||||||||||||||||| | |||||| |
|
|
| T |
3431400 |
tggtggtcggggtttgaacctcgtacattgcatatattatgcattcttcctacc |
3431347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 5279361 - 5279414
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| ||||||||| || | | |||||||||||||||||||||| |||| |
|
|
| T |
5279361 |
tggtggtcgaggtttgaactccagacattgcatatattatgcattgtccatacc |
5279414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 8094111 - 8094058
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||| ||||||| ||||||||||||||||||| |||| |||| |
|
|
| T |
8094111 |
tggtggccggggtttaaaccccgcaccttgcatatattatgcatcgtccatacc |
8094058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 8210376 - 8210429
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| |||||| || ||||| |||||||||||||||||| |||| |
|
|
| T |
8210376 |
tggtggccggggttcgaaccctggaccttgtatatattatgcattgtccttacc |
8210429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 9005749 - 9005696
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||||||| | |||| ||||||||||| |||||||||||| |
|
|
| T |
9005749 |
tggtggttggggtttgaacccatgaccttccatatattatgtattgtccctacc |
9005696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 10356174 - 10356227
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| ||| ||||||||| || ||||||||||||||||||||| |||| |
|
|
| T |
10356174 |
tggtggccggagttcgaaccccggaccgtgcatatattatgcattgtccatacc |
10356227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 11181926 - 11181979
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| | ||||||||||| |||| |
|
|
| T |
11181926 |
tggtggccggggtttgaaccccgcaccttgcatatttcatgcattgtccatacc |
11181979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 602 - 647
Target Start/End: Complemental strand, 14880891 - 14880846
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
|||| |||||||| | | |||||||||||||||||||||||||||| |
|
|
| T |
14880891 |
cgggatttgaacctcagaccttgcatatattatgcattgtccctac |
14880846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 607 - 648
Target Start/End: Complemental strand, 19620634 - 19620593
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
19620634 |
tttgaaccccggaccttgcatatattatgtattgtccttacc |
19620593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 597 - 634
Target Start/End: Complemental strand, 32561113 - 32561076
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattat |
634 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
32561113 |
gtggccggggtttgaacctcgggccttgcatatattat |
32561076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 32864362 - 32864309
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| | | ||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
32864362 |
tggtggtcggagctcgaaccccggactttgcatatattatgcattgtctctacc |
32864309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 32923888 - 32923835
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||| | | |||| |||||||||||||||||||||||| |
|
|
| T |
32923888 |
tggtggtcggagtttgaacttcagacctttcatatattatgcattgtccctacc |
32923835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 37045145 - 37045190
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
37045145 |
ggggttcgaaccctggaccttgcatatattatgcattgttcctacc |
37045190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 598 - 639
Target Start/End: Complemental strand, 37050996 - 37050955
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
37050996 |
tggtcggggttcgaaccccggaccttgcatattttatgcatt |
37050955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 40227899 - 40227846
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||||||| | ||||| |||| ||||||||||||| |||| |
|
|
| T |
40227899 |
tggtggtcggggttcgaaccccagaccttgtatattttatgcattgtccatacc |
40227846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 40411744 - 40411797
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||| || |||| |||| |||||| ||||||| |||| |
|
|
| T |
40411744 |
tggtggtcggggtttgaaccctggaccttacatacattatgtattgtccttacc |
40411797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 42888637 - 42888592
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
42888637 |
ggggttcgaaccccggaccttgcatattttatgcattgtccatacc |
42888592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 44243943 - 44243890
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||||| | || |||| ||||||||||||||||| |||||| |
|
|
| T |
44243943 |
tggtggttggggtttgaactctggaccttacatatattatgcattgttcctacc |
44243890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 45139997 - 45140050
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||| ||| | || |||||||||||||||||||||||| |||| |
|
|
| T |
45139997 |
tggtggccggggtttaaactctggaccttgcatatattatgcattgtccatacc |
45140050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 48646716 - 48646765
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcata-tattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||| ||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
48646716 |
tggtggccggagtttgaaccccggaccttgcatattattatgcattgtcc |
48646765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 50638907 - 50638960
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || |||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
50638907 |
tggtggccgggattcgaaccctggaccttgcatatattatgcattgtccttacc |
50638960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 64669 - 64717
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| || ||||||||| |||| | |||||||||||||||||||||| |
|
|
| T |
64669 |
tggtggacgaggtttgaactccggactttgcatatattatgcattgtcc |
64717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Original strand, 2889942 - 2889970
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2889942 |
ccttgcatatattatgcattgtccctacc |
2889970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 603 - 635
Target Start/End: Original strand, 3937521 - 3937553
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatg |
635 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
3937521 |
ggggtttgaaccccggaccttgcatatattatg |
3937553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 5869834 - 5869790
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
5869834 |
tggtggtcggggtttgaactccgaatcttgcatatattatgcatt |
5869790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 631
Target Start/End: Original strand, 6423752 - 6423788
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatat |
631 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
6423752 |
tggtggccggggtttgaaccccggaccttgcatatat |
6423788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 603 - 643
Target Start/End: Original strand, 9929230 - 9929270
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||| ||||| || |||||||||||||||||||||||| |
|
|
| T |
9929230 |
ggggttttaaccctggaccttgcatatattatgcattgtcc |
9929270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 10356706 - 10356749
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||| |||||||||| | |||||||||||||||||||| |
|
|
| T |
10356706 |
tggtggtcggg-tttgaaccccagaccttgcatatattatgcatt |
10356749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 594 - 642
Target Start/End: Original strand, 11462912 - 11462960
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||| |||||| ||||||||| |||||||||| |||||||||||| |
|
|
| T |
11462912 |
ttggtggatggggttcgaaccccggaccttgcatattttatgcattgtc |
11462960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 594 - 646
Target Start/End: Complemental strand, 12214063 - 12214012
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||||| ||||||| | |||||||||||||||| ||||| |||| |
|
|
| T |
12214063 |
ttggtggtcggggtt-gaaccccagaccttgcatatattatgtattgttccta |
12214012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 13778631 - 13778587
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
13778631 |
tggtggtcgaggtttgaaccccgaaccttgcatattttatgcatt |
13778587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 16967185 - 16967233
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
16967185 |
tggtggccggagtttgaacctcgaaccttgcatatattatgcattgtcc |
16967233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 17284012 - 17283968
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
17284012 |
gggttcgaaccctggaccttgcatatattatgcattgtccttacc |
17283968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 17917129 - 17917177
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||| |||| |||| ||||| ||||||||||||| |
|
|
| T |
17917129 |
tggtggtcggggtttgaatcccgaaccttacatattttatgcattgtcc |
17917177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 607 - 647
Target Start/End: Complemental strand, 21341242 - 21341202
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
21341242 |
tttgaacctcgaaccttgcatatattatgcattgtccctac |
21341202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Original strand, 21400039 - 21400067
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
21400039 |
ccttgcatatattatgcattgtccctacc |
21400067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 598 - 642
Target Start/End: Complemental strand, 28006809 - 28006765
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||| ||| |||| | ||||||||||||||||||||| |
|
|
| T |
28006809 |
tggtcggggtttaaactccggactttgcatatattatgcattgtc |
28006765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 598 - 642
Target Start/End: Complemental strand, 29506894 - 29506850
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||| |||||| || |||||||||||||||| |||||| |
|
|
| T |
29506894 |
tggtcggggttcgaaccctggaccttgcatatattatgtattgtc |
29506850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 29987103 - 29987151
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||| |||||| |||| || | |||||||||||||||||||||||| |
|
|
| T |
29987103 |
tggtggttggggttcgaactccagaccttgcatatattatgcattgtcc |
29987151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 32497481 - 32497525
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
32497481 |
gggtttgaaccctagaccttgcatatattatgcattgttcctacc |
32497525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 40734996 - 40735044
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| |||||||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
40734996 |
tggtggtcagggtttgaaccccgaaccttacatattttatgcattgtcc |
40735044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 43356505 - 43356457
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
43356505 |
tggtggtcggggtttgaactccaaaccttacatatattatgcattgtcc |
43356457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 45190269 - 45190313
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
45190269 |
gggtttgaatcccgaaccttgcatatattatgcattgtccatacc |
45190313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 46392303 - 46392259
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
46392303 |
tggtggtcggaatttgaaccccggaccttggatatattatgcatt |
46392259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 606 - 646
Target Start/End: Complemental strand, 49222875 - 49222835
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
49222875 |
gtttgaaccccggaccttgcatatattgtgcattgttccta |
49222835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 644
Target Start/End: Complemental strand, 50040417 - 50040377
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
|||||||||||| || |||||||||| |||||||||||||| |
|
|
| T |
50040417 |
gggtttgaaccctggaccttgcatattttatgcattgtccc |
50040377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 45; Significance: 3e-16; HSPs: 94)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 3e-16
Query Start/End: Original strand, 596 - 648
Target Start/End: Complemental strand, 19599214 - 19599162
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
19599214 |
ggtggtcggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
19599162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 0.000000000000001
Query Start/End: Original strand, 595 - 646
Target Start/End: Original strand, 48629056 - 48629107
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48629056 |
tggtggtcggggtttaaaccccggaccttgcatatattatgcattgtcccta |
48629107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 5579763 - 5579710
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| |||||||||| |
|
|
| T |
5579763 |
tggtggtcggggtttgaaccccagaccttgcatatattatgcactgtccctacc |
5579710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 27462427 - 27462480
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
27462427 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
27462480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 27833392 - 27833445
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
27833392 |
tggtggtcggggtttgaaccccggaccttacatatattatgcattgtccttacc |
27833445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 595 - 647
Target Start/End: Complemental strand, 18023749 - 18023697
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
|||||||||| |||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
18023749 |
tggtggtcggagtttgaaccctggaccttgcatatattatgcattgtccctac |
18023697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 18714511 - 18714465
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
18714511 |
cggggtttgaaccccggaccttgcatatattatgcattgtccttacc |
18714465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 19416584 - 19416531
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
19416584 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgtccatacc |
19416531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 603 - 647
Target Start/End: Complemental strand, 3830130 - 3830086
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
3830130 |
ggggtttgaaccctggaccttgcatatattatgcattgtccctac |
3830086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 597 - 641
Target Start/End: Complemental strand, 7670502 - 7670458
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7670502 |
gtggtcgaggtttgaaccccggaccttgcatatattatgcattgt |
7670458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 10244788 - 10244744
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
10244788 |
gggtttgaaccccggaccttgcatatattatgcattgtccatacc |
10244744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 18773747 - 18773795
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| ||||||||||||| |
|
|
| T |
18773747 |
tggtggtcggggtttgaaccccggaccttacatattttatgcattgtcc |
18773795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 597 - 641
Target Start/End: Complemental strand, 25602985 - 25602941
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25602985 |
gtggttggggtttcaaccccgggccttgcatatattatgcattgt |
25602941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 603 - 642
Target Start/End: Original strand, 20085758 - 20085797
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
20085758 |
ggggtttgaaccccggaccttgcatatattatgcattgtc |
20085797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 595 - 646
Target Start/End: Original strand, 42829225 - 42829276
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||| ||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42829225 |
tggtggccggagtttgaaccccggagcttgcatatattatgcattgtcccta |
42829276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 633
Target Start/End: Complemental strand, 145588 - 145550
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatatta |
633 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
145588 |
tggtggtcggggtttgaaccccggaccttgcatatatta |
145550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 3671894 - 3671848
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||||| |
|
|
| T |
3671894 |
tggtggtcggggtttgaactccagaccttgcatatattatgcattgt |
3671848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 19626518 - 19626564
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19626518 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgtcc |
19626564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 45088945 - 45088900
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
45088945 |
tggtggtcggggtttgaacccc-gaccttgcatatattatgcattgt |
45088900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 597 - 643
Target Start/End: Complemental strand, 46737853 - 46737807
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||| ||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
46737853 |
gtggccggtgtttgaaccccggaccttgcatatattatgcattgtcc |
46737807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 46987149 - 46987103
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
46987149 |
cggggttcgaaccccggaccttgcatatattatgcattgtccttacc |
46987103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 47342427 - 47342473
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
47342427 |
gtggtcggagtttgaactccggaccttgcatatattatgcattgtcc |
47342473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 3584274 - 3584221
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| | || |||||||||||||||||||||||| |||| |
|
|
| T |
3584274 |
tggtggtcggggtttgaatctcgtaccttgcatatattatgcattgtccttacc |
3584221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 644
Target Start/End: Original strand, 7388030 - 7388079
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
|||||||||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
7388030 |
tggtggtcggggtttgaatcccgaaccttacatatattatgcattgtccc |
7388079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 7994875 - 7994928
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| | |||| ||||||||||| ||||||||||| |
|
|
| T |
7994875 |
tggtggtcggggtttgaaccccagaccttacatatattatgttttgtccctacc |
7994928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 8084497 - 8084444
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||| ||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
8084497 |
tggtggccggggttcgaaccccggaccttgcatattttatgcattgtccatacc |
8084444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 15135154 - 15135101
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| |||| | |||||||||||||| ||||||||||||| |
|
|
| T |
15135154 |
tggtggtcggggtttgatccccagagcttgcatatattatacattgtccctacc |
15135101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 16577851 - 16577904
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
16577851 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctacc |
16577904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 16587811 - 16587758
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
16587811 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgtccctacc |
16587758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 21554925 - 21554978
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| || || |||||||||||||| ||||| |||||||| |
|
|
| T |
21554925 |
tggtggtcggggtttgaatcctggaccttgcatatattaagcattatccctacc |
21554978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 40187627 - 40187680
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||||||||||| | | |||| |||||||||||||||||||||||| |
|
|
| T |
40187627 |
tggtgttcggggtttgaaccgcagaccttacatatattatgcattgtccctacc |
40187680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 41029342 - 41029289
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||||||| |||||||| |||| |
|
|
| T |
41029342 |
tggtggtcgggattcgaaccccggaccttgcatatattatacattgtccttacc |
41029289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 602 - 647
Target Start/End: Original strand, 47155102 - 47155147
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
||||||| |||||| || |||||||||||||||||||||||||||| |
|
|
| T |
47155102 |
cggggttcgaaccctggaccttgcatatattatgcattgtccctac |
47155147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 6023379 - 6023331
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| ||||||||| |
|
|
| T |
6023379 |
tggtggtcggggtttgaaccccgaaccttgcatattttaagcattgtcc |
6023331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 10026064 - 10026016
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
10026064 |
tggtggtcggggtttgaaccccataccttgcatattttatgcattgtcc |
10026016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 10242550 - 10242506
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||| ||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
10242550 |
tggtgatcggggtttgaaccctggaccttgcatatattatgcatt |
10242506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 20763224 - 20763176
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
20763224 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20763176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 26529682 - 26529726
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
26529682 |
tggtggtcggggtttaaaccccgaaccttgcatatattatgcatt |
26529726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 28230849 - 28230801
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
28230849 |
tggtggtcggtgtttgaaccccggaccttgcatacatcatgcattgtcc |
28230801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 29488790 - 29488742
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
29488790 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
29488742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 33232388 - 33232436
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
33232388 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
33232436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 34284530 - 34284578
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
34284530 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
34284578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 46371051 - 46371007
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||||||||||||| |
|
|
| T |
46371051 |
tggtggtcggagtttgaaccccggaccttggatatattatgcatt |
46371007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 593 - 648
Target Start/End: Original strand, 8237621 - 8237676
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| ||||||||||||| ||| | ||| |||||||||||||||||| |||| |
|
|
| T |
8237621 |
gttggtggccggggtttgaacctcggactttgtatatattatgcattgtccttacc |
8237676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 598 - 641
Target Start/End: Original strand, 23198743 - 23198786
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||||||| | |||||||| ||||||||||| |
|
|
| T |
23198743 |
tggtcggggtttgaaccccggactttgcatattttatgcattgt |
23198786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 28736624 - 28736671
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||| |||||||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
28736624 |
tggtggttggggtttgaacctcggaccttgcatatatcatgcattgtc |
28736671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 598 - 641
Target Start/End: Complemental strand, 29726867 - 29726824
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
29726867 |
tggtcggggtttgaaccccgaaccttgcatatattatacattgt |
29726824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 603 - 646
Target Start/End: Complemental strand, 35222986 - 35222943
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
35222986 |
ggggtttgaaccccagaccttgcatatatcatgcattgtcccta |
35222943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 606 - 641
Target Start/End: Original strand, 39280820 - 39280855
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39280820 |
gtttgaaccccggaccttgcatatattatgcattgt |
39280855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 606 - 645
Target Start/End: Original strand, 42753529 - 42753568
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
42753529 |
gtttgaaccccggaccttgcatatattatgcactgtccct |
42753568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 610 - 648
Target Start/End: Complemental strand, 2618734 - 2618696
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
2618734 |
gaaccccggaccttgcatatattatgcattgtccttacc |
2618696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 648
Target Start/End: Complemental strand, 5041398 - 5041356
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
5041398 |
gtttgaaccccagaccttgcatatattatgcattgtccatacc |
5041356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 6781870 - 6781824
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||||||| |||| |
|
|
| T |
6781870 |
cggggtttgaaccctggaccttgcatattttatgcattgtccatacc |
6781824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 7735601 - 7735547
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||||| ||||||||||||| |||| |
|
|
| T |
7735601 |
ttggtggtcgggctttgaaccctagaccttgcatattttatgcattgtccatacc |
7735547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 8290460 - 8290514
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcata-tattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
8290460 |
tggtggtcgggattcgaaccccggaccttgcatattattatgcattgtccatacc |
8290514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 12167477 - 12167431
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||| |||||||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
12167477 |
tggtggttggggtttgaatcccggaccttgaatatattatgcattgt |
12167431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 594 - 648
Target Start/End: Original strand, 18505648 - 18505701
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||||||||||||| || ||||||||| |||||||||||||||||| |
|
|
| T |
18505648 |
ttggtagtcggggtttgaaccc-ggatcttgcatattttatgcattgtccctacc |
18505701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 34448603 - 34448649
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
34448603 |
gtggtcagggtttgaaccctggaccttacatatattatgcattgtcc |
34448649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 593 - 639
Target Start/End: Original strand, 37495907 - 37495953
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||| |||||||| || |||||||||||||||||||| |
|
|
| T |
37495907 |
gttggtggtcgggatttgaaccttggaccttgcatatattatgcatt |
37495953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 38374189 - 38374235
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| || ||||||||||| |||||||||||| |||| |
|
|
| T |
38374189 |
cggggtttgaaccctggaccttgcatatactatgcattgtccatacc |
38374235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 605 - 643
Target Start/End: Original strand, 42095944 - 42095982
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
42095944 |
ggtttgaaccccggaccttgcatatattatgcatggtcc |
42095982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 604 - 646
Target Start/End: Original strand, 43539104 - 43539146
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||| |||| |
|
|
| T |
43539104 |
gggtttgaaccccggaccttacatatattatgcattgttccta |
43539146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 44434099 - 44434045
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatata-ttatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| |||||||| ||| | ||||||||| |||||||||||||||||| |
|
|
| T |
44434099 |
tggtggtcgggatttgaacctcggactttgcatatatttatgcattgtccctacc |
44434045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 580917 - 580970
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||| ||||||||||||| |||| |
|
|
| T |
580917 |
tggtggtcggggttcgaacgccggatcttgcatattttatgcattgtccatacc |
580970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 21105673 - 21105620
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||||| || |||||||||||||||||||| ||| |||| |
|
|
| T |
21105673 |
tggtggtcggggttcgaacctcgaaccttgcatatattatgcattttccatacc |
21105620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 21174429 - 21174376
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| ||| |||||| ||| ||||||||||||| |
|
|
| T |
21174429 |
tggtggccggggtttgaaccccggaactttcatatagtattcattgtccctacc |
21174376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 21322245 - 21322192
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||| |||||||||| ||| |||| |
|
|
| T |
21322245 |
tggtggccggggtttgaaccctggaccttgcatacattatgcattatccttacc |
21322192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 31038513 - 31038566
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||| | ||||||||| | |||||||||||| |||| |
|
|
| T |
31038513 |
tggtggccggggtttgaaccccagaccttgcatacaatatgcattgtccatacc |
31038566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 597 - 638
Target Start/End: Complemental strand, 36121720 - 36121679
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcat |
638 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
36121720 |
gtggccggggtttgaaccccggaccttgcatattttatgcat |
36121679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 598 - 643
Target Start/End: Original strand, 37516796 - 37516841
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
37516796 |
tggtcgaggtttgaactccggaccttgcatatgttatgcattgtcc |
37516841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 37624613 - 37624560
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
37624613 |
tggtggccgggattcgaacccccgaccttgcatatattatgcattgtccatacc |
37624560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 37930114 - 37930061
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||||||||||||||| |||| |
|
|
| T |
37930114 |
tggtggtcggggtttgaatcccgaatcctgcatatattatgcattgtccttacc |
37930061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 39801776 - 39801723
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||||| | ||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
39801776 |
tggtggttggggttcgtaccccggatcttgcatatattatgcattgtccatacc |
39801723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 594 - 643
Target Start/End: Complemental strand, 42336141 - 42336092
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| | || ||||||||| |||||||| ||||||||||||||| |
|
|
| T |
42336141 |
ttggtggtcgagattcgaaccccggaccttgcatgtattatgcattgtcc |
42336092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 597 - 638
Target Start/End: Complemental strand, 43139333 - 43139292
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcat |
638 |
Q |
| |
|
||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
43139333 |
gtggtcggggtttgaaccccgtaccttgcatattttatgcat |
43139292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 47607901 - 47607954
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| |||||||||| || |||||||||||||||| | |||||||||| |
|
|
| T |
47607901 |
tggtggccggagtttgaaccctggaccttgcatatattatgtaatgtccctacc |
47607954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 4905346 - 4905298
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
4905346 |
tggtggccggggtttgaactccgaaccttgcatattttatgcattgtcc |
4905298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 7872748 - 7872792
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
7872748 |
gggttcgaaccccagaccttgcatatattatgcattgtccttacc |
7872792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 14046602 - 14046646
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14046602 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14046646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 14356632 - 14356676
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
14356632 |
tggtggccggggtttgaaccccgtatcttgcatatattatgcatt |
14356676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 14671240 - 14671192
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||| ||||| || ||||||||| ||||| |||||||||||||||||| |
|
|
| T |
14671240 |
tggtgatcgggattcgaaccccggaccttgtatatattatgcattgtcc |
14671192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 18684199 - 18684156
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||| |||||||||| |
|
|
| T |
18684199 |
tggtggtcggggtttgaa-cccggaccttgcatacattatgcatt |
18684156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 19036093 - 19036141
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
19036093 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgtcc |
19036141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 20718543 - 20718495
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
20718543 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgtcc |
20718495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 602 - 634
Target Start/End: Complemental strand, 23147353 - 23147321
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattat |
634 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
23147353 |
cggggtttgaaccccggaccttgcatatattat |
23147321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 26717919 - 26717963
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||||| | |||||||||| || |||||||||||||||||||| |
|
|
| T |
26717919 |
tggtggtcagagtttgaaccctggaccttgcatatattatgcatt |
26717963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 33473512 - 33473560
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| | ||||| |||||| || |||||||||||||||||||||||| |
|
|
| T |
33473512 |
tggtggccagggttggaaccctggaccttgcatatattatgcattgtcc |
33473560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 33610916 - 33610964
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||| ||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
33610916 |
tggtggccggtgttcgaactccggaccttgcatatattatgcattgtcc |
33610964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Complemental strand, 34773276 - 34773248
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34773276 |
ccttgcatatattatgcattgtccctacc |
34773248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 40752830 - 40752878
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||| ||||||||| | |||||||||||||| ||||||| |
|
|
| T |
40752830 |
tggtggccggggttcgaaccccggacattgcatatattatgtattgtcc |
40752878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 606 - 642
Target Start/End: Complemental strand, 40867089 - 40867053
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
40867089 |
gtttgaaccccggaccttgcatatactatgcattgtc |
40867053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 42227796 - 42227844
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| ||||||||| || |||| ||||||||||||||||||| |
|
|
| T |
42227796 |
tggtggtcggagtttgaacctcgaaccttacatatattatgcattgtcc |
42227844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 635
Target Start/End: Original strand, 45046206 - 45046246
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatg |
635 |
Q |
| |
|
|||||||| | ||||||||||||| |||||||||||||||| |
|
|
| T |
45046206 |
tggtggtcagagtttgaaccccggaccttgcatatattatg |
45046246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 48527260 - 48527212
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||| || |||| |||| |||||||||||||||||||||||| |
|
|
| T |
48527260 |
tggtggccgggattcgaactccggaccttgcatatattatgcattgtcc |
48527212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 85)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 8881345 - 8881292
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
8881345 |
tggtggccggggtttgaaccctggaccttgcatatattatgcattgtccctacc |
8881292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 11709056 - 11709003
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
11709056 |
tggtggtcggggtttgaacttcggaccttgcatatattatgcattgtccctacc |
11709003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 12748971 - 12748918
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
12748971 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
12748918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 12800891 - 12800944
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
12800891 |
tggtggtcggggtttgaaccccggaccttgcatatattatgtattgtccatacc |
12800944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 19163527 - 19163580
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
19163527 |
tggtggtcggggtttgaaccccggaccttgcataaattatgcattgtccatacc |
19163580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 32051523 - 32051571
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32051523 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtcc |
32051571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 26799255 - 26799201
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
26799255 |
ttggtggtcggggttttaaccccgaaccttgcatattttatgcattgtccctacc |
26799201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 444483 - 444430
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
444483 |
tggtggccggggtttaaaccccggaccttgcatatattatgcattgtccttacc |
444430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 7997010 - 7996957
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
7997010 |
tggtggtcggggtttgaaccccagaccttgcatatattatgcgttgtccatacc |
7996957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 594 - 643
Target Start/End: Complemental strand, 23159512 - 23159463
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23159512 |
ttggtggtcggggtttgaaccccgaatcttgcatatattatgcattgtcc |
23159463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 27587291 - 27587238
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||| ||||||||||| |||| |
|
|
| T |
27587291 |
tggtggccggggtttgaaccccggaccttgcatatatcatgcattgtccttacc |
27587238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 594 - 643
Target Start/End: Original strand, 27718884 - 27718933
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
27718884 |
ttggtggtcggagtttgaactccggaccttgcatatattatgcattgtcc |
27718933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 14598189 - 14598237
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
14598189 |
tggtggtcggggtttgaaccccgcaccttgcttatattatgcattgtcc |
14598237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 597 - 641
Target Start/End: Original strand, 24023408 - 24023452
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
24023408 |
gtggtcggggtttgaaccccggaccttgcatattttatgcattgt |
24023452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 24838161 - 24838209
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
24838161 |
tggtggccggggtttgaaccccggaccttgcatattttatgcattgtcc |
24838209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 39821945 - 39821901
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||| | ||||||||||||||||||||||||||||| |
|
|
| T |
39821945 |
gggtttgaaccccagaccttgcatatattatgcattgtccctacc |
39821901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 597 - 644
Target Start/End: Original strand, 8461829 - 8461876
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| |||||||||||||| |
|
|
| T |
8461829 |
gtggtcggggtttgaactccggaccttgcatattttatgcattgtccc |
8461876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 605 - 648
Target Start/End: Complemental strand, 13105154 - 13105111
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13105154 |
ggttcgaaccccggcccttgcatatattatgcattgtccctacc |
13105111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 597 - 643
Target Start/End: Complemental strand, 11053044 - 11052998
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
11053044 |
gtggtcggggttcaaaccccggaccttgcatatattatgcattgtcc |
11052998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 18533739 - 18533693
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
18533739 |
tggtggttggggtttgaaccccggatcttgcatatattatgcattgt |
18533693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 19260570 - 19260616
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
19260570 |
tggtggccggggtttgaaccccggaccttacatatattatgcattgt |
19260616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 603 - 641
Target Start/End: Complemental strand, 33105453 - 33105415
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33105453 |
ggggtttgaaccccggaccttgcatatattatgcattgt |
33105415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 8717466 - 8717519
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || ||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8717466 |
tggtggccgaggtttgaaccccgaaccttgcatatattatgcattgtccatacc |
8717519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29376971 - 29376918
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||| ||||||||| |||| |
|
|
| T |
29376971 |
tggtggtcggggtttgaactccagaccttgcatatattacgcattgtccatacc |
29376918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 32944831 - 32944884
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||| ||||||||||||| |||| |
|
|
| T |
32944831 |
tggtggtcggggtttgaacctcagaccttgcatattttatgcattgtccatacc |
32944884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 33996139 - 33996086
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
33996139 |
tggtggtcggagtttgaaccccgaactttgcatatattatgcattgtctctacc |
33996086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 37141427 - 37141374
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
37141427 |
tggtggccggagtttgaaccccgaaccttgcatatattatgcattgtccatacc |
37141374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 8999882 - 8999926
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
||||||||||||||||||||| || | |||||||||||||||||| |
|
|
| T |
8999882 |
tggtggtcggggtttgaaccctggactttgcatatattatgcatt |
8999926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 20665354 - 20665402
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
20665354 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
20665402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 22775698 - 22775650
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| | ||||||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
22775698 |
tggtggccagggtttgaaccccggaccttgcataaattatgcattgtcc |
22775650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 26932754 - 26932802
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| ||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
26932754 |
tggtggtcgtggtttgaaccctggaccttgcatatatcatgcattgtcc |
26932802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 594 - 642
Target Start/End: Original strand, 27571839 - 27571887
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
27571839 |
ttggtggtcgggatttgaaccccaaaccttgcatatattatgcattgtc |
27571887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 602 - 638
Target Start/End: Original strand, 30176417 - 30176453
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcat |
638 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30176417 |
cggggtttgaaccccggaccttgcatatattatgcat |
30176453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 30550717 - 30550765
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
30550717 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
30550765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 600 - 648
Target Start/End: Original strand, 31336803 - 31336851
Alignment:
| Q |
600 |
gtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
31336803 |
gtcggggtttgaaccctagaccttgcatatattatgcattgttcctacc |
31336851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 600 - 648
Target Start/End: Complemental strand, 32192959 - 32192911
Alignment:
| Q |
600 |
gtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
32192959 |
gtcggggttcgaaccccgaaccttgcatatattatgcattgtccatacc |
32192911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 596 - 648
Target Start/End: Complemental strand, 36781477 - 36781425
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| |||||||| | |||||||||||||| ||||||| |||| |
|
|
| T |
36781477 |
ggtggtcggggtttaaaccccggactttgcatatattatgtattgtccttacc |
36781425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 44215466 - 44215514
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
44215466 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
44215514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 604 - 647
Target Start/End: Original strand, 2908097 - 2908140
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
||||| ||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
2908097 |
gggttcgaaccccggcccctgcatatattatgcattgtccctac |
2908140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 648
Target Start/End: Complemental strand, 4830076 - 4830025
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| || |||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
4830076 |
gtggtcgggattcgaaccccgaaccttgcatatattatgcattgtccatacc |
4830025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 646
Target Start/End: Complemental strand, 6471581 - 6471530
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||| |||||||||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
6471581 |
tggtggccggggtttgaaccccgaacattgcatatattatgcattgttccta |
6471530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Original strand, 10871895 - 10871938
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
10871895 |
ggtttgaaccccggaccttgcatacattatgcattgtccatacc |
10871938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 602 - 641
Target Start/End: Original strand, 13124361 - 13124400
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
13124361 |
cggggtttgaaccccggaccttgcatattttatgcattgt |
13124400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 611 - 646
Target Start/End: Original strand, 22948088 - 22948123
Alignment:
| Q |
611 |
aaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
22948088 |
aaccccggaccttgcatatattatgcattgtcccta |
22948123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 646
Target Start/End: Complemental strand, 29546963 - 29546912
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||| ||||||||||||| | ||||||||||||||| |||||||||| |
|
|
| T |
29546963 |
tggtggtcagggtttgaaccccagaccttgcatatattatctattgtcccta |
29546912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 601 - 648
Target Start/End: Complemental strand, 30623357 - 30623310
Alignment:
| Q |
601 |
tcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
30623357 |
tcggggttcgaaccccagaccttgcatatattatgcattgtccttacc |
30623310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 643
Target Start/End: Original strand, 34645078 - 34645125
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcata-tattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
34645078 |
gtggtcggggttcgaaccccggaccttgcatattattatgcattgtcc |
34645125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 42172234 - 42172281
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||| ||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
42172234 |
tggtggttggggtttgaactccggatcttgcatatattatgcattgtc |
42172281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Original strand, 42208470 - 42208513
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
42208470 |
ggtttgaacctcggaccttgcatatattatgcattgtccttacc |
42208513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 44632176 - 44632223
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
44632176 |
tggtggtcggggtttgaaccccgaaccttatatatattatgcattgtc |
44632223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 606 - 648
Target Start/End: Complemental strand, 7553738 - 7553696
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
7553738 |
gtttgaaccttggaccttgcatatattatgcattgtccctacc |
7553696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 9598669 - 9598623
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
9598669 |
tggtggtcgggatttgaaccccgggccttggatacattatgtattgt |
9598623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 607 - 645
Target Start/End: Original strand, 12714373 - 12714411
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12714373 |
tttgaaccccgaaccttgcatatattatgcattgtccct |
12714411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 18942981 - 18942935
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||| |||||||| |
|
|
| T |
18942981 |
cggggtttgaaacccggaccatgcatatattatgcattatccctacc |
18942935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 610 - 648
Target Start/End: Complemental strand, 19778120 - 19778082
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
19778120 |
gaaccccggaccttgcatatattatgcattgtccttacc |
19778082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 29652288 - 29652242
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||| ||||||||| | || |||||||||||||||||||||| |
|
|
| T |
29652288 |
tggtggtcgaggtttgaactctggaccttgcatatattatgcattgt |
29652242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 31832088 - 31832134
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||| ||||| | ||||||||||||||||||||||||||| |
|
|
| T |
31832088 |
cggggttcgaaacccggacattgcatatattatgcattgtccctacc |
31832134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 596 - 642
Target Start/End: Complemental strand, 44794962 - 44794916
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||| || ||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
44794962 |
ggtggccgaggtttgaactccggaccttgcatatattatgcattgtc |
44794916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 6235542 - 6235595
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||| ||||| |||| |||||||||||||| |||| |||| |
|
|
| T |
6235542 |
tggtggccggggtttgaatcccggaccttacatatattatgcatcgtccatacc |
6235595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 607 - 648
Target Start/End: Complemental strand, 6447247 - 6447206
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
6447247 |
tttgaactccggaccttgcatatattatgcattgtccatacc |
6447206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 602 - 643
Target Start/End: Original strand, 7869639 - 7869680
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7869639 |
cggggtttgaacccccaaccttgcatatattatgcattgtcc |
7869680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 13357432 - 13357485
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
13357432 |
tggtggccgaggtttgaacctcgtaccttgcatatattatgcattgtccatacc |
13357485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 15020831 - 15020778
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| | ||||||||||||||| |||||||||||||| |||||||| |||| |
|
|
| T |
15020831 |
tggtggccagggtttgaaccccggatcttgcatatattatacattgtccatacc |
15020778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 611 - 648
Target Start/End: Complemental strand, 15438507 - 15438470
Alignment:
| Q |
611 |
aaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
15438507 |
aaccccggaccttgcatatattatgcattgtccttacc |
15438470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 611 - 648
Target Start/End: Complemental strand, 15529811 - 15529774
Alignment:
| Q |
611 |
aaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
15529811 |
aaccccggaccttgcatatattatgcattgtccttacc |
15529774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 20275188 - 20275233
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
20275188 |
ggggtttgaaccccgaaccttgcatgtattatgcattgtccttacc |
20275233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 21061815 - 21061860
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
21061815 |
ggggtttgaaccccgaaccttgcatgtattatgcattgtccttacc |
21061860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 24023699 - 24023752
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | ||||| |||| ||| |||| |
|
|
| T |
24023699 |
tggtggtcggggtttgaaccccggaccttgcagacattatacattatccatacc |
24023752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 596 - 641
Target Start/End: Complemental strand, 24195318 - 24195273
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||| |||| ||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24195318 |
ggtgatcggagtttgaaccccggaccttgcatatattatgtattgt |
24195273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 29716691 - 29716744
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| ||||||| ||||| |||||||||||||||| ||||| |||||| |
|
|
| T |
29716691 |
tggtggccggagtttgaatcccggaccttgcatatattatgaattgttcctacc |
29716744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 35700386 - 35700439
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
35700386 |
tggtggtcggagtttgaaccccgaattttgcatatattatgcattgtctctacc |
35700439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 40167392 - 40167339
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||| |||| ||||| |||||||||||||||||| |||| |
|
|
| T |
40167392 |
tggtggccggggtttgaatcccgaaccttgtatatattatgcattgtccatacc |
40167339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 3650590 - 3650546
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3650590 |
tggtggccggggtttgaaccccgaaccttacatatattatgcatt |
3650546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 603 - 647
Target Start/End: Complemental strand, 4077751 - 4077707
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |||| |
|
|
| T |
4077751 |
ggggtttgaaccccgaaccttgcatatattatgaattgtcgctac |
4077707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 9478026 - 9478074
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||| |||||||| |||| | ||||||||| |||||||||||||| |
|
|
| T |
9478026 |
tggtggtcagggtttgatccccagaccttgcatacattatgcattgtcc |
9478074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 596 - 648
Target Start/End: Original strand, 9655989 - 9656041
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||| ||||| ||| |||||||||| ||||||||||||| |||| |
|
|
| T |
9655989 |
ggtggttggggttcgaacctcggaccttgcatattttatgcattgtccttacc |
9656041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 11603828 - 11603876
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| ||||||||| || |||||||||||||||||||||||| |
|
|
| T |
11603828 |
tggtggtcgaggtttgaactcccaaccttgcatatattatgcattgtcc |
11603876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Original strand, 15079168 - 15079196
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15079168 |
ccttgcatatattatgcattgtccctacc |
15079196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 635
Target Start/End: Original strand, 15147020 - 15147060
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatg |
635 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||||||||||| |
|
|
| T |
15147020 |
tggtggtcgggatttgagccccggaccttgcatatattatg |
15147060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 21557503 - 21557455
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| || ||||| ||| |||| ||||||||||||||||||| |
|
|
| T |
21557503 |
tggtggtcgggattcgaacctcggaccttacatatattatgcattgtcc |
21557455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 26991748 - 26991796
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26991748 |
tggtggtcgtggtttgaaccacaaaccttgcatatattatgcattgtcc |
26991796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Complemental strand, 29908056 - 29908028
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29908056 |
ccttgcatatattatgcattgtccctacc |
29908028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 32421630 - 32421586
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
32421630 |
gggtttgaaccccggaccttgcatatattatatattgtccatacc |
32421586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 602 - 646
Target Start/End: Original strand, 33482147 - 33482191
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||| ||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
33482147 |
cgggatttgaaccctggaccttgcataaattatgcattgtcccta |
33482191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 38763506 - 38763554
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| | ||||| ||||||| | |||||||||||||||||||||||| |
|
|
| T |
38763506 |
tggtggccagggttcgaaccccagaccttgcatatattatgcattgtcc |
38763554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.00000000000002; HSPs: 70)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 8569779 - 8569726
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8569779 |
tggtggccggggtttgaaccccggaccttgcatatattatgcattgtccatacc |
8569726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 14918293 - 14918344
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||||||||| |
|
|
| T |
14918293 |
gtggtcggggtttgaaccccagaccttgtatatattatgcattgtccctacc |
14918344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 597 - 648
Target Start/End: Complemental strand, 20744206 - 20744155
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
20744206 |
gtggtcggggtttgaaccccagaccttgcatatattatgcattgtccatacc |
20744155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 15187133 - 15187087
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
15187133 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcattgt |
15187087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 15473473 - 15473519
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
15473473 |
tggtggtcggggtttgaacctcggaccttgcatatattatgcattgt |
15473519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 16390500 - 16390446
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| || |||||||||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
16390500 |
ttggtggccgaggtttgaaccccggaccttacatatattatgcattgtccctacc |
16390446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 788936 - 788883
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
788936 |
tggtggtcggggtttgaactccgaaccttgcatatattatgcattgtccttacc |
788883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 4455587 - 4455640
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| |||||| |||| |
|
|
| T |
4455587 |
tggtggtcggggtttgaaccccagaccttgcatatattatgccttgtccatacc |
4455640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 8629687 - 8629740
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
8629687 |
tggtggtcgaggtttgaaccccgaaccttgcatatattatgcattgtccatacc |
8629740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 27834409 - 27834356
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| ||||||||||||| | ||||||||||||||||| ||||||||||| |
|
|
| T |
27834409 |
tggtggtccgggtttgaaccccagaccttgcatatattatgccttgtccctacc |
27834356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29740552 - 29740499
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
29740552 |
tggtggccggggtttgaaccccggaccttgcgtatattatgcattgtccatacc |
29740499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 32524411 - 32524464
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
32524411 |
tggtggttggggtttgaaccctggactttgcatatattatgcattgtccctacc |
32524464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 594 - 643
Target Start/End: Complemental strand, 33824952 - 33824903
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||| || |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
33824952 |
ttggtggccgaggtttgaaccccggaccttgcatatattatgcattgtcc |
33824903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 604 - 648
Target Start/End: Original strand, 8637437 - 8637481
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
8637437 |
gggtttgaacctcggaccttgcatatattatgcattgtccctacc |
8637481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 16204781 - 16204829
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
16204781 |
tggtggtcgggatttgaaccccggaccttgcatacattatgcattgtcc |
16204829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 24623308 - 24623356
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
24623308 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgtcc |
24623356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 37; E-Value: 0.00000000002
Query Start/End: Original strand, 597 - 641
Target Start/End: Original strand, 34481407 - 34481451
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
34481407 |
gtggtcggggtttgaaccccggaccttgcatatataatgcattgt |
34481451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 598 - 641
Target Start/End: Complemental strand, 13496183 - 13496140
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
13496183 |
tggtcggggtttgaactccggaccttgcatatattatgcattgt |
13496140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 595 - 646
Target Start/End: Original strand, 28231416 - 28231467
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||| ||| || |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
28231416 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcattgtcccta |
28231467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 602 - 648
Target Start/End: Original strand, 2726415 - 2726461
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
2726415 |
cggggttcgaaccccggaccttgcatatattatgcattgtccatacc |
2726461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 15155805 - 15155759
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||||||| |
|
|
| T |
15155805 |
tggtggtcgtggtttgaaccccagaccttgcatatattatgcattgt |
15155759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 15170001 - 15169955
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
15170001 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15169955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 595 - 641
Target Start/End: Complemental strand, 15178773 - 15178727
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
15178773 |
tggtggtcggggtttgaaccccgaaccttacatatattatgcattgt |
15178727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 597 - 642
Target Start/End: Original strand, 655742 - 655787
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||| ||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
655742 |
gtggccggggttcgaaccccggaccttgcatatattatgcattgtc |
655787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 9977127 - 9977074
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| ||||||||||||| | |||||||||||||||||||| ||| |||| |
|
|
| T |
9977127 |
tggtggtcagggtttgaaccccagaccttgcatatattatgcattatccatacc |
9977074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 24373709 - 24373754
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||||| ||||| |
|
|
| T |
24373709 |
ggggtttgaacccctgaccttgcatatattatgcattgtctctacc |
24373754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 602 - 643
Target Start/End: Complemental strand, 33976307 - 33976266
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
33976307 |
cggggtttgaaccccggaccttgcatattttatgcattgtcc |
33976266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 247729 - 247681
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
247729 |
tggtggccggggtttgaactccggaccttgcatattttatgcattgtcc |
247681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 635
Target Start/End: Complemental strand, 2546250 - 2546210
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatg |
635 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2546250 |
tggtggtcggggtttgaaccccgtaccttgcatatattatg |
2546210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 601 - 641
Target Start/End: Complemental strand, 9111111 - 9111071
Alignment:
| Q |
601 |
tcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
9111111 |
tcggggttcgaaccccggaccttgcatatattatgcattgt |
9111071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 9367471 - 9367423
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||| ||||||||||||| |
|
|
| T |
9367471 |
tggtggtcggggtttgaatcccagaccttgcatattttatgcattgtcc |
9367423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 647
Target Start/End: Original strand, 27080795 - 27080847
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
|||||||||||||||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
27080795 |
tggtggtcggggtttgaattccagagcttgcatatattatgcattgtccctac |
27080847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 596 - 648
Target Start/End: Complemental strand, 28898925 - 28898873
Alignment:
| Q |
596 |
ggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||| |||||||||||| |||| |||| ||||||||||||||||||| |||| |
|
|
| T |
28898925 |
ggtggccggggtttgaactccggacctttcatatattatgcattgtccttacc |
28898873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 604 - 648
Target Start/End: Complemental strand, 31971590 - 31971546
Alignment:
| Q |
604 |
gggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
31971590 |
gggtttgaacctcggaccttgcatatattatgcattgtccttacc |
31971546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 603 - 638
Target Start/End: Complemental strand, 291429 - 291394
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcat |
638 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
291429 |
ggggtttgaaccccggaccttgcatatattatgcat |
291394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 598 - 641
Target Start/End: Complemental strand, 8809373 - 8809330
Alignment:
| Q |
598 |
tggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
8809373 |
tggtcggggtttgaacctcggatcttgcatatattatgcattgt |
8809330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 646
Target Start/End: Original strand, 12232173 - 12232224
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||||||||| ||||||| | | |||||||||||||||||||||||| |
|
|
| T |
12232173 |
tggtggtcggggttcgaaccccagacactgcatatattatgcattgtcccta |
12232224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 648
Target Start/End: Original strand, 22792933 - 22792984
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| | |||||| |||| |
|
|
| T |
22792933 |
gtggtcggggtttgaaccccggaccttacatatattattcgttgtccttacc |
22792984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 23903298 - 23903345
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||||||||||| |
|
|
| T |
23903298 |
tggtggtcggtgtttgaaccccgaacgttgcatatattatgcattgtc |
23903345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 597 - 644
Target Start/End: Original strand, 26356074 - 26356121
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
|||| ||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26356074 |
gtggccggagtttgaaccccgaaccttgcatatattatgcattgtccc |
26356121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 593 - 648
Target Start/End: Complemental strand, 26400936 - 26400881
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| ||||||| |||||||| |||||||||||||||| ||||||| |||| |
|
|
| T |
26400936 |
gttggtggccggggttcaaaccccggaccttgcatatattatgtattgtccatacc |
26400881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 642
Target Start/End: Original strand, 27080689 - 27080736
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||| |
|
|
| T |
27080689 |
tggtggtcggggtttgaatcccagagcttgcatatattatgcattgtc |
27080736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 646
Target Start/End: Complemental strand, 29680658 - 29680607
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||||||| |||||||| ||| |||||||||||||||||||| |||||| |
|
|
| T |
29680658 |
tggtggtcggagtttgaacaccgaaccttgcatatattatgcattatcccta |
29680607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 593 - 648
Target Start/End: Complemental strand, 32053860 - 32053805
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||| ||| ||||||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
32053860 |
gttggtggccggagtttgaaccacgaaccttgcatatattatgcattgtccatacc |
32053805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 595 - 638
Target Start/End: Complemental strand, 32621442 - 32621399
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcat |
638 |
Q |
| |
|
|||||||||||||||||| ||||| |||| |||||||||||||| |
|
|
| T |
32621442 |
tggtggtcggggtttgaatcccggaccttacatatattatgcat |
32621399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 607 - 641
Target Start/End: Complemental strand, 12215811 - 12215777
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
12215811 |
tttgaaccccggaccttgcatatattatgcattgt |
12215777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 645
Target Start/End: Original strand, 12591018 - 12591068
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
||||||| ||||||| || |||| |||||||||||||||||||||||||| |
|
|
| T |
12591018 |
tggtggttggggtttaaatcccgaaccttgcatatattatgcattgtccct |
12591068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 603 - 641
Target Start/End: Original strand, 18253338 - 18253376
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
18253338 |
ggggtttgaaccctggaccttgcatatattatgcattgt |
18253376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 28758281 - 28758327
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||| |||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
28758281 |
tggtgttcggggtttgaacctcggactttgcatatattatgcattgt |
28758327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 34750528 - 34750574
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||||| |||| |||| |
|
|
| T |
34750528 |
tggtggtcggggttcgaaccccaggccttgcatatataatgcgttgt |
34750574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 607 - 648
Target Start/End: Original strand, 8916477 - 8916518
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||| |||||||||||||||| |||||||||||| |
|
|
| T |
8916477 |
tttgaactccggaccttgcatatattatgtattgtccctacc |
8916518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 11456367 - 11456419
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||||||||||||| |||| ||||||||||||||||||| |||| |
|
|
| T |
11456367 |
tggtggccggggtttgaaccccga-ccttacatatattatgcattgtccatacc |
11456419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 14296948 - 14297001
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||| ||||| ||||||| |||| |
|
|
| T |
14296948 |
tggtggccggggtttgaaccccggaccttacatattttatgtattgtccatacc |
14297001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 17151306 - 17151253
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| || |||||||||||| | |||||||||||||||| |||||| ||||| |
|
|
| T |
17151306 |
tggtggccgaggtttgaaccccagaccttgcatatattatgtattgtcactacc |
17151253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 21847264 - 21847211
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || |||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
21847264 |
tggtggccgggattcgaaccccgtaccttgcatatattatgtattgtccctacc |
21847211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 29283885 - 29283832
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||| ||||||| ||||| |
|
|
| T |
29283885 |
tggtggtcggagtttgaaccctagaccttgcatatattatacattgtctctacc |
29283832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 30938453 - 30938408
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||| || ||||||||||||||| |||||||||| |
|
|
| T |
30938453 |
ggggttcgaaccccggtccctgcatatattatgcaatgtccctacc |
30938408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 34701217 - 34701164
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||| ||||||||| | | |||||||||||||||||||||| |||||| |
|
|
| T |
34701217 |
tggtggccggagtttgaacctcagaccttgcatatattatgcattgttcctacc |
34701164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 603 - 643
Target Start/End: Original strand, 3808117 - 3808157
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| | ||| |||||||||||||||||||||||| |
|
|
| T |
3808117 |
ggggtttgaatctcggaccttgcatatattatgcattgtcc |
3808157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 610 - 642
Target Start/End: Complemental strand, 4450317 - 4450285
Alignment:
| Q |
610 |
gaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
4450317 |
gaaccccggaccttgcatatattatgcattgtc |
4450285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 608 - 648
Target Start/End: Complemental strand, 8831264 - 8831224
Alignment:
| Q |
608 |
ttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||| |||| |
|
|
| T |
8831264 |
ttgaaccccggaccttgcataaattatgcattgtccttacc |
8831224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 9392659 - 9392703
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||| |||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
9392659 |
tggtagtcggggtttaaacctcggaccttgcatatattatgcatt |
9392703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 601 - 645
Target Start/End: Complemental strand, 9763499 - 9763455
Alignment:
| Q |
601 |
tcggggtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
|||||||| ||||||||| || |||||||| |||||||||||||| |
|
|
| T |
9763499 |
tcggggttggaaccccggcccatgcatataatatgcattgtccct |
9763455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 620 - 648
Target Start/End: Original strand, 10780123 - 10780151
Alignment:
| Q |
620 |
ccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10780123 |
ccttgcatatattatgcattgtccctacc |
10780151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Complemental strand, 12184578 - 12184534
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| |||| |||||||| ||| |||||||||||||||||||| |
|
|
| T |
12184578 |
tggtggccgggatttgaaccacggaccttgcatatattatgcatt |
12184534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Original strand, 12582220 - 12582268
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||| |||||||||||| || | |||||||||| ||||||||||||| |
|
|
| T |
12582220 |
tggtggccggggtttgaactccagaccttgcatattttatgcattgtcc |
12582268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 643
Target Start/End: Complemental strand, 17935799 - 17935751
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
||||||||||| ||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
17935799 |
tggtggtcgggatttgaaccctagaccttgcatattttatgcattgtcc |
17935751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 600 - 648
Target Start/End: Original strand, 18254097 - 18254145
Alignment:
| Q |
600 |
gtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||| ||| ||||| |||||||| ||||||||||||||| |||| |
|
|
| T |
18254097 |
gtcggggttcgaatcccggaccttgcatgtattatgcattgtccttacc |
18254145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 606 - 642
Target Start/End: Original strand, 19265526 - 19265562
Alignment:
| Q |
606 |
gtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
19265526 |
gtttgaaccccggaccttgcatattttatgcattgtc |
19265562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 595 - 639
Target Start/End: Original strand, 27907942 - 27907986
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcatt |
639 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||| ||||||||| |
|
|
| T |
27907942 |
tggtggccggggtttgaaccccagaccttgcatattttatgcatt |
27907986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 595 - 645
Target Start/End: Original strand, 53371 - 53421
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccct |
645 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||||||||| |
|
|
| T |
53371 |
tggtggtcggggtttgaaccccagaccttgcatattttatgcattgtccct |
53421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0025 (Bit Score: 39; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0025
Description:
Target: scaffold0025; HSP #1
Raw Score: 39; E-Value: 0.000000000001
Query Start/End: Original strand, 594 - 648
Target Start/End: Complemental strand, 64289 - 64235
Alignment:
| Q |
594 |
ttggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||| ||| ||||| |||||||||||||||||||||||| |||| |
|
|
| T |
64289 |
ttggtggtcggggttcgaatcccggaccttgcatatattatgcattgtccatacc |
64235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1127 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold1127
Description:
Target: scaffold1127; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 1164 - 1209
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
1164 |
ggggtttgaaccccggaccttgcatatattatgcattgttcctacc |
1209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 38; Significance: 0.000000000004; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 38; E-Value: 0.000000000004
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 161211 - 161158
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
161211 |
tggtggtcggggtttgaaccccgaaccttgcatattttatgcattgtccatacc |
161158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0038 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0038
Description:
Target: scaffold0038; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 595 - 646
Target Start/End: Original strand, 31913 - 31964
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||||| ||| || |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31913 |
tggtggccggagtgtgaaccccggaccttgcatatattatgcattgtcccta |
31964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 36; Significance: 0.00000000006; HSPs: 1)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 36; E-Value: 0.00000000006
Query Start/End: Original strand, 595 - 646
Target Start/End: Complemental strand, 99107 - 99056
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||| ||||| ||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
99107 |
tggttgtcggagtttgaaccccagaccttgcatatattatgcattgtcccta |
99056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 5252 - 5199
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||| |||||||||||| | | |||||||||||||||||||||||| |||| |
|
|
| T |
5252 |
tggtggttggggtttgaacctcagaccttgcatatattatgcattgtccatacc |
5199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 34; Significance: 0.0000000009; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 75395 - 75342
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||| || ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
75395 |
tggtggccgggattcgaaccccggaccttgcatatattatgcattgtccttacc |
75342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 34; Significance: 0.0000000009; HSPs: 2)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 34; E-Value: 0.0000000009
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 7792 - 7739
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||| | ||||||||||||| |||| |
|
|
| T |
7792 |
tggtggtcggggtttgaacctcggaccttgcatgttttatgcattgtccatacc |
7739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011; HSP #2
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 185326 - 185280
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||| |||| |
|
|
| T |
185326 |
cggggtttgaaccccggatcttgcatattttatgcattgtccatacc |
185280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0071 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0071
Description:
Target: scaffold0071; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 595 - 647
Target Start/End: Complemental strand, 53495 - 53443
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctac |
647 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||| |||| ||||||||||| |
|
|
| T |
53495 |
tggtggtcggggtttgaatcccggaccttgcatatgttatatattgtccctac |
53443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0028 (Bit Score: 33; Significance: 0.000000004; HSPs: 1)
Name: scaffold0028
Description:
Target: scaffold0028; HSP #1
Raw Score: 33; E-Value: 0.000000004
Query Start/End: Original strand, 600 - 644
Target Start/End: Original strand, 72771 - 72815
Alignment:
| Q |
600 |
gtcggggtttgaaccccgggccttgcatatattatgcattgtccc |
644 |
Q |
| |
|
||||| |||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
72771 |
gtcggagtttgaaccctggaccttgcatatattatgcattgtccc |
72815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1619 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1619
Description:
Target: scaffold1619; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 603 - 642
Target Start/End: Complemental strand, 1093 - 1054
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtc |
642 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
1093 |
ggggtttgaatcccggaccttgcatatattatgcattgtc |
1054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1149 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold1149
Description:
Target: scaffold1149; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 605 - 648
Target Start/End: Complemental strand, 2392 - 2349
Alignment:
| Q |
605 |
ggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2392 |
ggtttgaaccccaaaccttgcatatattatgcattgtccctacc |
2349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 595 - 641
Target Start/End: Original strand, 14177 - 14223
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
14177 |
tggtggtcggggtttgaaccacataccttgcatatattatgcattgt |
14223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 31; Significance: 0.00000006; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 31; E-Value: 0.00000006
Query Start/End: Original strand, 602 - 648
Target Start/End: Complemental strand, 239870 - 239824
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| |||| | |||||||||||||||||||||| |||| |
|
|
| T |
239870 |
cggggtttgaactccggactttgcatatattatgcattgtccttacc |
239824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1120 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold1120
Description:
Target: scaffold1120; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 1975 - 1930
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||| |||||| |
|
|
| T |
1975 |
ggggtttgaaccacgaaccttgcatatattatgcattgttcctacc |
1930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0735 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0735
Description:
Target: scaffold0735; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 1590 - 1545
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| ||||||||| |||||||||| ||||||||||||| |||| |
|
|
| T |
1590 |
ggggttcgaaccccggaccttgcatattttatgcattgtccatacc |
1545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0262 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0262
Description:
Target: scaffold0262; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Original strand, 15929 - 15974
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||||| | ||||||||||||||| |||||||| |||| |
|
|
| T |
15929 |
ggggtttgaaccccagaccttgcatatattatacattgtccttacc |
15974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0259 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0259
Description:
Target: scaffold0259; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Complemental strand, 5483 - 5430
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||||||||| | ||||||| | |||||||||| ||||||||||||| |||| |
|
|
| T |
5483 |
tggtggtcggggatcgaaccccagaccttgcatattttatgcattgtccatacc |
5430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 603 - 648
Target Start/End: Complemental strand, 25451 - 25406
Alignment:
| Q |
603 |
ggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
|||||| |||||| || |||||||||||||||||||||||| |||| |
|
|
| T |
25451 |
ggggttcgaaccctggaccttgcatatattatgcattgtccttacc |
25406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 595 - 648
Target Start/End: Original strand, 221004 - 221057
Alignment:
| Q |
595 |
tggtggtcggggtttgaaccccgggccttgcatatattatgcattgtccctacc |
648 |
Q |
| |
|
||||||||||||||||||||| | | |||||||||||||| ||| |||||||| |
|
|
| T |
221004 |
tggtggtcggggtttgaaccctagactttgcatatattatgtattatccctacc |
221057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0143 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0143
Description:
Target: scaffold0143; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 602 - 646
Target Start/End: Complemental strand, 4529 - 4485
Alignment:
| Q |
602 |
cggggtttgaaccccgggccttgcatatattatgcattgtcccta |
646 |
Q |
| |
|
|||| ||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
4529 |
cgggatttgaaccctggaccttgcataaattatgcattgtcccta |
4485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 597 - 644
Target Start/End: Original strand, 3568 - 3616
Alignment:
| Q |
597 |
gtggtcggggtttgaaccccgggcc-ttgcatatattatgcattgtccc |
644 |
Q |
| |
|
||||| |||||||||||||||| || |||||||| |||||||||||||| |
|
|
| T |
3568 |
gtggttggggtttgaaccccggacctttgcatattttatgcattgtccc |
3616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 607 - 643
Target Start/End: Original strand, 42337 - 42373
Alignment:
| Q |
607 |
tttgaaccccgggccttgcatatattatgcattgtcc |
643 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |
|
|
| T |
42337 |
tttgaaccccagaccttgcatatattatgcattgtcc |
42373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 29; Significance: 0.0000009; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 593 - 641
Target Start/End: Complemental strand, 48719 - 48671
Alignment:
| Q |
593 |
gttggtggtcggggtttgaaccccgggccttgcatatattatgcattgt |
641 |
Q |
| |
|
||||||| ||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
48719 |
gttggtgtccggggtttgaatcccggactttgcatatattatgcattgt |
48671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University