View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4117_high_11 (Length: 250)
Name: NF4117_high_11
Description: NF4117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4117_high_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 9 - 250
Target Start/End: Complemental strand, 32796240 - 32796003
Alignment:
| Q |
9 |
agcagagaagttagttgtcggatcaaaaggtgcaaattttattaatacataagttgcataaagaaagaatctctaagtatatgaagagtagtttcattct |
108 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| |
|
|
| T |
32796240 |
agcagagaagttagttgtccgatcaaaaggtgtaaattttattaatacataagttgcataaagaa----tctctaagtacatgaagagtagtttcattct |
32796145 |
T |
 |
| Q |
109 |
ccatccaataggggcccaaaccccacataatgtgaagaattttcaaaatatgtgaagaaccctatgatgttgaaaggacttgtttggtctagtggtttga |
208 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
32796144 |
ccatcctataggggcccaaaccccacataatgtgaagaattttcaaaatatgtgaagaaccttgtgatgttgaaaggacttgtttggtctagtggtttga |
32796045 |
T |
 |
| Q |
209 |
tagttgttcggtcatggggtcgattttgttcaaccacaaatt |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32796044 |
tagttgttcggtcatggggtcgattttgttcagccacaaatt |
32796003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University