View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4117_high_12 (Length: 243)
Name: NF4117_high_12
Description: NF4117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4117_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 18 - 225
Target Start/End: Complemental strand, 29525329 - 29525122
Alignment:
| Q |
18 |
acaacatttactgaattttcttcaagtataatgtctactacaccttgatcacttccacaactagcaacttctggtatggtaactgaactgtcaataactt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29525329 |
acaacatttactgaattttcttcaagtataatgtctactacaccttgatcacttccacaactagcaacttctggtatggtaactgaactgtcaataactt |
29525230 |
T |
 |
| Q |
118 |
gaccttcactagatacctcttgttggtaatctagatatgaatcaataataacacgactttcatgggcaacatctggttgacctgtattaccaacctctgg |
217 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29525229 |
gaccttcactagatacctcttgttggttatctagatatgaatcaataataacacgactttcatgggcaacatctggttgaactgtattaccaacctctgg |
29525130 |
T |
 |
| Q |
218 |
atcagaac |
225 |
Q |
| |
|
|||||||| |
|
|
| T |
29525129 |
atcagaac |
29525122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 110 - 169
Target Start/End: Complemental strand, 29613035 - 29612976
Alignment:
| Q |
110 |
aataacttgaccttcactagatacctcttgttggtaatctagatatgaatcaataataac |
169 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||| ||||| ||||||| ||||||||||| |
|
|
| T |
29613035 |
aatatcttgaccttcactagatacctctttttggcaatctggatatgactcaataataac |
29612976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 184 - 225
Target Start/End: Complemental strand, 29612952 - 29612911
Alignment:
| Q |
184 |
caacatctggttgacctgtattaccaacctctggatcagaac |
225 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
29612952 |
caacatctggttgacctacattaccaacctctggatcagaac |
29612911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University