View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4117_high_13 (Length: 238)
Name: NF4117_high_13
Description: NF4117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4117_high_13 |
 |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0060 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 75447 - 75665
Alignment:
| Q |
1 |
taaggactttggtgggaagaactttgttttgttctacttaaatgtggatgttgactatattagggaacaatttcagtttgtttgagttgcagtgtttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
75447 |
taaggactttggtgggaagaactttgttttgttctactcaaatgtagatgttgactatattagggaacaatttcagtttgtttgagttacagtgtttatt |
75546 |
T |
 |
| Q |
101 |
ttagattgggacttaatgctttggactaactgtgttgccttttgtttttaatggattaaatgtggtttaattgatttcatggaatggagactagtatagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75547 |
ttagattgggacttaatgctttggactaactgtcttgccttttgtttttaatggattaaatgtggtttaattgatttcatggaatggagactagtatagt |
75646 |
T |
 |
| Q |
201 |
caaggtttgagctgcagga |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
75647 |
gaaggtttgagctgcagga |
75665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 8434976 - 8434758
Alignment:
| Q |
1 |
taaggactttggtgggaagaactttgttttgttctacttaaatgtggatgttgactatattagggaacaatttcagtttgtttgagttgcagtgtttatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
8434976 |
taaggactttggtgggaagaactttgttttgttctactcaaatgtagatgttgactatattagggaacaatttcagtttgtttgagttacagtgtttatt |
8434877 |
T |
 |
| Q |
101 |
ttagattgggacttaatgctttggactaactgtgttgccttttgtttttaatggattaaatgtggtttaattgatttcatggaatggagactagtatagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8434876 |
ttagattgggacttaatgctttggactaactgtcttgccttttgtttttaatggattaaatatggtttaattgatttcatggaatggagactagtatagt |
8434777 |
T |
 |
| Q |
201 |
caaggtttgagctgcagga |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8434776 |
caaggtttgagctgcagga |
8434758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 64 - 168
Target Start/End: Original strand, 8390783 - 8390887
Alignment:
| Q |
64 |
ggaacaatttcagtttgtttgagttgcagtgtttattttagattgggacttaatgctttggactaactgtgttgccttttgtttttaatggattaaatgt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| ||||||| ||| |||| || |||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
8390783 |
ggaacaatttcagtttgtttgagttgcagtgttgattttggattggggctttatgccttagactaattgtcttgccttttgtttttaatggattaaatgt |
8390882 |
T |
 |
| Q |
164 |
ggttt |
168 |
Q |
| |
|
||||| |
|
|
| T |
8390883 |
ggttt |
8390887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 4 - 114
Target Start/End: Complemental strand, 8378300 - 8378190
Alignment:
| Q |
4 |
ggactttggtgggaagaactttgttttgttctacttaaatgtggatgttgactatattagggaacaatttcagtttgtttgagttgcagtgtttatttta |
103 |
Q |
| |
|
|||| |||||||||||||||| |||||||| |||| ||||||||||||||||| | |||| ||| | | |||||||||||||| |||||| |||| |
|
|
| T |
8378300 |
ggacattggtgggaagaacttggttttgttttactcaaatgtggatgttgactgtgttagagaattgtgtaagtttgtttgagttttagtgttgcttttg |
8378201 |
T |
 |
| Q |
104 |
gattgggactt |
114 |
Q |
| |
|
| ||||||||| |
|
|
| T |
8378200 |
gtttgggactt |
8378190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University