View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4117_high_7 (Length: 300)
Name: NF4117_high_7
Description: NF4117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4117_high_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 12 - 282
Target Start/End: Original strand, 40465607 - 40465877
Alignment:
| Q |
12 |
atcatcactatgggctgctaaggtaatagaaagttatctatatgtttgtttattgctaataatatagcttttgatcaatggatttatagtagcacattca |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465607 |
atcatcactatgggctgctaaggtaatagaaagttatctatatgtttgtttattgctaataatatagcttttgatcaatggatttatagtagcacattca |
40465706 |
T |
|
| Q |
112 |
tataggcgttatgataaattaccttatgcaggagagcataattgaagagattgaagacgatttggattctgagcattatgatgcatctgtggattccgat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465707 |
tataggcgttatgataaattaccttatgcaggagagcataattgaagagattgaagacgatttggattctgagcattatgatgcatctgtggattccgat |
40465806 |
T |
|
| Q |
212 |
aaaatcaatattttctcacctgaacctaagaaaaatatcaaggatgaagatgttgaacaaaaagtatatcg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40465807 |
aaaatcaatattttctcacctgaacctaagaaaaatatcaaggatgaagatgttgaaccaaaagtatatcg |
40465877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University