View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4117_low_13 (Length: 250)
Name: NF4117_low_13
Description: NF4117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4117_low_13 |
 | |
|
| [»] scaffold0060 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 8435012 - 8435249
Alignment:
| Q |
1 |
ataattaaataggcatttgcataaatcactaatgtgtagacaaaataattagcaaaaacaggcatctctatatagccactgcacaattcggaaccattgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
8435012 |
ataattaaataggcatttgcataaatcactaatgtgtagacaaaataattagcaaaaacaggcatctctatatagccactacacaattcggaaccattgg |
8435111 |
T |
|
| Q |
101 |
caactcatcaccatgaggaccactcagagatagagacactacagtttcttcgtttaattttcattgcagcgtcacatttttagatcatcgacaaatttac |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8435112 |
caactaatcaccatgaggaccactcagagatagagacattacagtttcttcgtttaattttcattgcagc--cacatttttagatcatcgacaaagttac |
8435209 |
T |
|
| Q |
201 |
cattagaattatataatattgctatcattttcggcctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8435210 |
cattagaattatataatattgctatcattttcggcctttg |
8435249 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 75411 - 75367
Alignment:
| Q |
1 |
ataattaaataggcatttgcataaatcactaatgtgtagacaaaa |
45 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75411 |
ataattaaataggcatttgcataaatcactaatgtgtagacaaaa |
75367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University