View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4117_low_14 (Length: 250)
Name: NF4117_low_14
Description: NF4117
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4117_low_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 17 - 250
Target Start/End: Original strand, 14695392 - 14695625
Alignment:
| Q |
17 |
cgtgagaggtgtgtcgacgaggtatcacagtgtcagcgacgtatcagaannnnnnnnnnnnnnnnnnnaattnnnnnnnttccgacacttcttcgataca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
14695392 |
cgtgagaggtgtgtcgacgaggtatcacagtgtcagcgacgtatcagaattttttattttatttttttaattaaaaaaattccgacacttcttcgatact |
14695491 |
T |
 |
| Q |
117 |
tatggatggtgtatcaaagcatatcgacgcatcggtacatattagatacaatttgatgaccatttaaacgtatctatgcttcataagttgtaacactgta |
216 |
Q |
| |
|
|||||||||||||||||||||| || ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
14695492 |
tatggatggtgtatcaaagcatctctacgcatcagtacatattagatacaatttgatgaccatttaaacgtatatatgcttcataagttgtaacactata |
14695591 |
T |
 |
| Q |
217 |
aactctaattaattcactgccaataagatggaac |
250 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
14695592 |
aactctaattaattcactgccaataagttggaac |
14695625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University