View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4118_high_2 (Length: 360)
Name: NF4118_high_2
Description: NF4118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4118_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 15 - 277
Target Start/End: Complemental strand, 13383068 - 13382801
Alignment:
| Q |
15 |
aggcaaaggagatcgtgtcttccaatcccgtcgttgttttcaggtaaatcgttttctctcattacttcatctttttt--ctgttgattcattgtttgtaa |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |||||| |||||| ||||||||| ||||||||||| |
|
|
| T |
13383068 |
aggcaaaggagatcgtgtcttccaatcccgtcgtcgttttcaggtaaatccttttctctcattccttcattttttttttctgttgatttattgtttgtaa |
13382969 |
T |
 |
| Q |
113 |
taataacaacgctgatttgtttaattcggtgattgattgattgattgaa---nnnnnnngcagtaaaagctattgtcccttttgcgttcaagtgaagaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13382968 |
taataacaacgctgatttgtttaattcggtgattgattgattgattgaattttttttcttcagcaaaagctattgtcccttttgcgttcaagtgaagaaa |
13382869 |
T |
 |
| Q |
210 |
ctcttcactgatttgggtgtcactttcaaagccgttgaactcgattctgaatgtaagtgctttcacat |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13382868 |
ctcttcactgatttgggtgtcactttcaaagccgttgaactcgattctgaatgtaaatgctttcacat |
13382801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University