View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4118_high_4 (Length: 347)
Name: NF4118_high_4
Description: NF4118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4118_high_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Original strand, 3112649 - 3112984
Alignment:
| Q |
1 |
attctcacgaggaataacgaaccgttcacgtggcggaacgtgatcaccgatttcgtgcatttcgccatcgacgatccaccattctgatctttcctccggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3112649 |
attctcacgaggaataacgaaccgttcacgtggcggaacgtgatcaccgatttcgtgcatttcgccatcgacgatccaccattctgatctttcctccggt |
3112748 |
T |
 |
| Q |
101 |
tttttgagcggaagaggcgtagacttggggcggcgtctggaatgggtgggggcgggttgaggaggagagcggagttgatgggaggtgcgagaaagaaagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3112749 |
tttttgagcggaagaggcgtagacttggggcggcgtctggaatgggtgggggagggttgaggaggagagcgaagttgatgggaggtgcgagaaagaaagg |
3112848 |
T |
 |
| Q |
201 |
gggtgagagaggaaaggcgtttggtgagagatagcatggattggatttgaatggattcaaatgtgttgcttctgatgattttgaggtttagggtttaaga |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3112849 |
gggtgagagaggaaaggcgtttggtgagagatagcatggattggatttgaatggattcaaatgtgttgcttctgatgattttgaggtttagggtttaaga |
3112948 |
T |
 |
| Q |
301 |
agaagataacaactgtggagagattttcaatttcat |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
3112949 |
agaagataacaactgtggagagattttcaatttcat |
3112984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University