View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4118_low_2 (Length: 222)
Name: NF4118_low_2
Description: NF4118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4118_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 71 - 215
Target Start/End: Complemental strand, 250395 - 250250
Alignment:
| Q |
71 |
agagagaga-aagacaaggtagaagaaaggaagtcaaaatacgacagacataaatattgactagactcacgtgttgcttctcttctactggccccaccac |
169 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
250395 |
agagagagagaagacaaggtagaagaaaggaagtcaaaatacgacagacataaacattgactagactcacgcgttgcttctcttctactggccccaccac |
250296 |
T |
|
| Q |
170 |
catatatatgctttacttcacattgggtctctctcttgtgatgatg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
250295 |
catatatatgctttacttcacattgggtctctctcttgtgatgatg |
250250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 250480 - 250419
Alignment:
| Q |
13 |
aacacagacagataaatcaaactacacatattcattctttctttatgagttttaagaaagagag |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
250480 |
aacacagacagataaatcaaactacacatattcattctttctttctgag--ttaagaaagagag |
250419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University