View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4120_low_3 (Length: 370)
Name: NF4120_low_3
Description: NF4120
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4120_low_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 22 - 332
Target Start/End: Original strand, 29943207 - 29943517
Alignment:
| Q |
22 |
cttaaggttgaaaactgattgttggataactttactttgttgataatgtaaagataaatgaggataaatgtgcaaaactgaaattttttgttaatacgct |
121 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
29943207 |
cttaaggttgaaaaccgattgttggataactttactttgctgataatgtaaagataaatgaggataaatgttcaaaattgaaattttttgttaatacgct |
29943306 |
T |
|
| Q |
122 |
tgcaacaattgtcaaggatcttatgaagcgacgcttctccttccagtgcattcatttagaataaatttgtttgttttttaggtacccttgtttgcgtgga |
221 |
Q |
| |
|
||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29943307 |
tgcaacaattgccaaggatcttatgaagtgacgcttctccttccagtgcattcatttagaataaatttgttagttttttaggtacccttgtttgcgtgga |
29943406 |
T |
|
| Q |
222 |
gatttgtgaataataggtttcatacaaaaaacggtctaactaaacgtggattttacaatctaatttaagatcgtgtgtggcaggtgtggtatagaggaaa |
321 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29943407 |
gattggtgaataataggtttcatacaaaaaacggtcttactaaacgtggattttacaatctaatttaagatcgtgtgtggcaggtgtggtatagaggaaa |
29943506 |
T |
|
| Q |
322 |
caattcaatat |
332 |
Q |
| |
|
||||||||||| |
|
|
| T |
29943507 |
caattcaatat |
29943517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University