View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4121_high_2 (Length: 420)
Name: NF4121_high_2
Description: NF4121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4121_high_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 285; Significance: 1e-159; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 285; E-Value: 1e-159
Query Start/End: Original strand, 100 - 396
Target Start/End: Original strand, 2348596 - 2348892
Alignment:
| Q |
100 |
tgacccattttacattcaagtcttttccttgaaccccaaatgaaaactttgaaacagcccattatgcaaaatagaatgaaaagaggaagaaggtaccctt |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
2348596 |
tgacccattttacattaaagtcttttccttgaaccccaaatgaaaactttgaaacagcccattatgcaaaatggaatgaaaagaggaagaaggtaccctt |
2348695 |
T |
|
| Q |
200 |
gaaatcggagttggtcttcggggacattgtcaatgagattgatctgatcgtataaagagaaagcgcgacggagagaaggcagggaattgggattgttgtg |
299 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348696 |
gaaatcggagctggtcttcggggacattgtcaatgagattgatctgatcgtataaagagaaagcgcgacggagagaaggcagggaattgggattgttgtg |
2348795 |
T |
|
| Q |
300 |
aggagagggtttgagcttgagaggatgttcgttgcggagactgcgtatgaggtttggaagtgctgttactgctctttgtcgaacagccatctttttg |
396 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348796 |
aggagagggtttgagcttgagaggatgttcgttgcggagactgcgtatgaggtttggaagtgctgttactgctctttgtcgaacagccatctttttg |
2348892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 18 - 65
Target Start/End: Original strand, 2348505 - 2348552
Alignment:
| Q |
18 |
ttaagtcccttcagcaatgcaattattggctatgatataatgatctta |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2348505 |
ttaagtcccttcagcaatgcaattattggctatgatataatgatctta |
2348552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University