View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4121_low_9 (Length: 220)

Name: NF4121_low_9
Description: NF4121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4121_low_9
NF4121_low_9
[»] chr8 (1 HSPs)
chr8 (11-220)||(8229998-8230207)


Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 11 - 220
Target Start/End: Complemental strand, 8230207 - 8229998
Alignment:
11 cagagaggaccatgctttcgagttggtaaaacatatagcatctctaaatgggattcaagttatgaagttgaacttggattggataaaaaccaaccatata 110  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8230207 cagaaaggaccatgctttcgagttggtaaaacatatagcatctctaaatgggattcaagttatgaagttgaacttggattggataaaaaccaaccatata 8230108  T
111 attataaaatagaaagcagcacttgcaagccagcttgcaaaataatggacaagaatggagtgatagttgcagaggtaattaagatctctaacattttttc 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
8230107 attataaaatagaaagcagcacttgcaagccagcttgcaaaataatggacaagaatggagtgatagttgcagaggtaattaagatttctaacattttttc 8230008  T
211 agcaaagttt 220  Q
    ||||||||||    
8230007 agcaaagttt 8229998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University