View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4122_high_6 (Length: 313)
Name: NF4122_high_6
Description: NF4122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4122_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 99; Significance: 7e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 197 - 307
Target Start/End: Complemental strand, 24228588 - 24228478
Alignment:
| Q |
197 |
attaatcaattggtcaatgtgtaaacgatagcgtgattccttatatgaccttttttcatccttagaaacaccaatccgaccgaaatacaaaaacagcact |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
24228588 |
attaatcaattggtcaatgtgtaaacgatagcgtgattccttagatgaccttttttcatccttagaaacaccaaaccgaccgaaatacaaaaacaccact |
24228489 |
T |
|
| Q |
297 |
attttagcttt |
307 |
Q |
| |
|
||||||||||| |
|
|
| T |
24228488 |
attttagcttt |
24228478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University